From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01420
  • pan locus tag?: SAUPAN003835000
  • symbol: SAOUHSC_01420
  • pan gene symbol?: arlR
  • synonym:
  • product: DNA-binding response regulator

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01420
  • symbol: SAOUHSC_01420
  • product: DNA-binding response regulator
  • replicon: chromosome
  • strand: -
  • coordinates: 1361633..1362292
  • length: 660
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGACGCAAATTTTAATAGTAGAAGATGAACAAAACTTAGCAAGATTTCTTGAATTGGAA
    CTCACACATGAAAATTACAATGTGGACACAGAGTATGATGGACAAGACGGTTTAGATAAA
    GCGCTTAGCCATTACTATGATTTAATCATATTAGATTTAATGTTGCCGTCAATTAATGGC
    TTAGAAATTTGTCGCAAAATTAGACAACAACAATCTACACCTATCATTATAATTACAGCG
    AAAAGTGATACGTATGACAAAGTTGCTGGGCTTGATTACGGTGCAGACGATTATATAGTT
    AAGCCGTTTGATATTGAAGAACTTTTAGCAAGAATTCGTGCAATTTTACGTCGTCAGCCA
    CAAAAGGATATTATCGATGTCAACGGTATTACAATTGATAAGAACGCTTTTAAAGTGACG
    GTAAATGGCGCAGAAATTGAATTAACAAAAACAGAGTATGATTTACTATATCTTCTAGCT
    GAAAATAAAAACCATGTTATGCAACGGGAACAAATTTTAAATCATGTATGGGGTTATAAT
    AGTGAAGTAGAAACAAATGTCGTAGATGTTTATATAAGATATTTACGAAACAAGTTAAAA
    CCATACGATCGTGACAAAATGATTGAAACAGTTCGTGGCGTTGGGTATGTGATACGATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_01420
  • symbol: SAOUHSC_01420
  • description: DNA-binding response regulator
  • length: 219
  • theoretical pI: 4.63339
  • theoretical MW: 25497.9
  • GRAVY: -0.331507

⊟Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 226.4)
    Signal transduction Signal transduction Two-component systems phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 226.4)
    Signal transduction Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 221)
    and 8 more
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 113.5)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Signal transduction Regulatory functions DNA interactions nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Signal transduction Signal transduction Two-component systems nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Cellular processes Cellular processes Sporulation and germination sporulation transcription factor Spo0A (TIGR02875; HMM-score: 57.7)
    Signal transduction Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 32.6)
    Signal transduction Regulatory functions DNA interactions PEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 31)
    Genetic information processing Mobile and extrachromosomal element functions Prophage functions putative phage terminase, small subunit, P27 family (TIGR01558; HMM-score: 13)
  • TheSEED  :
    • Two-component system response regulator ArlR
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 105.7)
    HTH (CL0123) Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 96.8)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.001435
    • TAT(Tat/SPI): 0.000091
    • LIPO(Sec/SPII): 0.000226
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MTQILIVEDEQNLARFLELELTHENYNVDTEYDGQDGLDKALSHYYDLIILDLMLPSINGLEICRKIRQQQSTPIIIITAKSDTYDKVAGLDYGADDYIVKPFDIEELLARIRAILRRQPQKDIIDVNGITIDKNAFKVTVNGAEIELTKTEYDLLYLLAENKNHVMQREQILNHVWGYNSEVETNVVDVYIRYLRNKLKPYDRDKMIETVRGVGYVIR

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [1] [2]
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator: SigB* (activation) regulon
    SigB*(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation;  [3]   other strains

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. ↑ 3.0 3.1 3.2 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

B Fournier, R Aras, D C Hooper
Expression of the multidrug resistance transporter NorA from Staphylococcus aureus is modified by a two-component regulatory system.
J Bacteriol: 2000, 182(3);664-71
[PubMed:10633099] [WorldCat.org] [DOI] (P p)B Fournier, D C Hooper
A new two-component regulatory system involved in adhesion, autolysis, and extracellular proteolytic activity of Staphylococcus aureus.
J Bacteriol: 2000, 182(14);3955-64
[PubMed:10869073] [WorldCat.org] [DOI] (P p)B Fournier, A Klier, G Rapoport
The two-component system ArlS-ArlR is a regulator of virulence gene expression in Staphylococcus aureus.
Mol Microbiol: 2001, 41(1);247-61
[PubMed:11454217] [WorldCat.org] [DOI] (P p)S S Ingavale, W Van Wamel, A L Cheung
Characterization of RAT, an autolysis regulator in Staphylococcus aureus.
Mol Microbiol: 2003, 48(6);1451-66
[PubMed:12791130] [WorldCat.org] [DOI] (P p)Adhar C Manna, Susham S Ingavale, MaryBeth Maloney, Willem van Wamel, Ambrose L Cheung
Identification of sarV (SA2062), a new transcriptional regulator, is repressed by SarA and MgrA (SA0641) and involved in the regulation of autolysis in Staphylococcus aureus.
J Bacteriol: 2004, 186(16);5267-80
[PubMed:15292128] [WorldCat.org] [DOI] (P p)Bénédicte Fournier, André Klier
Protein A gene expression is regulated by DNA supercoiling which is modified by the ArlS-ArlR two-component system of Staphylococcus aureus.
Microbiology (Reading): 2004, 150(Pt 11);3807-3819
[PubMed:15528666] [WorldCat.org] [DOI] (P p)Alejandro Toledo-Arana, Nekane Merino, Marta Vergara-Irigaray, Michel Débarbouillé, José R Penadés, Iñigo Lasa
Staphylococcus aureus develops an alternative, ica-independent biofilm in the absence of the arlRS two-component system.
J Bacteriol: 2005, 187(15);5318-29
[PubMed:16030226] [WorldCat.org] [DOI] (P p)

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SAOUHSC_01420&oldid=101396"