From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02636
  • pan locus tag?: SAUPAN005864000
  • symbol: SAOUHSC_02636
  • pan gene symbol?: tcaR
  • synonym:
  • product:

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: pseudogene
  • locus tag: SAOUHSC_02636
  • symbol: SAOUHSC_02636
  • product:
  • replicon: chromosome
  • strand: -
  • coordinates: 2423442..2423897
  • length: 456
  • essential: no [1] DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGGTAAAACATTTACAAGACCATATTCAATTTTTAGAGCAGTTTATAAATAACGTTAAC
    GCATTAACTGCAAAAATGTTGAAAGATTTACAAAATGAATATGAAATTTCATTAGAGCAG
    TCTAACGTATTAGGTATGTTAAATAAAGAACCTTTGACAATTAGTGAAATCACGCAAAGA
    CAAGGTGTAAATAAGGCCGCAGTAAGCCGACGAATTAAAAAGTTAATCGATGCTTAATTA
    GTTAAGTTAGATAAACCAAATTTAAATATTGATCAACGTTTGAAATTCATAACCTTAACT
    GACAAAGGTAGAGCATATTTGAAAGAACGTAATGCGATTATGACAGATATTGCGCAAGAT
    ATTACTAATGATTTAAATTCTGAAGATATTGAAAATGTAAGGCAAGTATTAGAAGTCATC
    AATCATCGCATTAAAACATATAGCAATCATAAATAG
    60
    120
    180
    240
    300
    360
    420
    456


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_02636
  • symbol: SAOUHSC_02636
  • description:
  • length:
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED  :
    • Teicoplanin-resistance associated HTH-type transcriptional regulator TcaR
    Regulation and Cell signaling Quorum sensing and biofilm formation Biofilm formation in Staphylococcus  Teicoplanin-resistance associated HTH-type transcriptional regulator TcaR
    and 1 more
    Virulence, Disease and Defense Resistance to antibiotics and toxic compounds Teicoplanin-resistance in Staphylococcus  Teicoplanin-resistance associated HTH-type transcriptional regulator TcaR
  • PFAM:

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb:
  • DeepLocPro:
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt: Q2FVR6 UniProt
  • STRING: 93061.SAOUHSC_02636 STRING

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

Experimental data[edit | edit source]

  • experimentally validated: data available for COL
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: SigB* (activation) regulon
    SigB*(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation;  [2]   other strains

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Roy R Chaudhuri, Andrew G Allen, Paul J Owen, Gil Shalom, Karl Stone, Marcus Harrison, Timothy A Burgis, Michael Lockyer, Jorge Garcia-Lara, Simon J Foster, Stephen J Pleasance, Sarah E Peters, Duncan J Maskell, Ian G Charles
    Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH).
    BMC Genomics: 2009, 10;291
    [PubMed:19570206] [WorldCat.org] [DOI] (I e)
  2. 2.0 2.1 2.2 2.3 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]