Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL1272 [new locus tag: SACOL_RS06495 ]
- pan locus tag?: SAUPAN003553000
- symbol: codY
- pan gene symbol?: codY
- synonym:
- product: transcriptional repressor CodY
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL1272 [new locus tag: SACOL_RS06495 ]
- symbol: codY
- product: transcriptional repressor CodY
- replicon: chromosome
- strand: +
- coordinates: 1283471..1284244
- length: 774
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3238033 NCBI
- RefSeq: YP_186130 NCBI
- BioCyc: see SACOL_RS06495
- MicrobesOnline: 912736 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGAGCTTATTATCTAAAACGAGAGAGTTAAACACGTTACTTCAAAAACACAAAGGTATT
GCGGTTGATTTTAAAGATGTAGCACAAACGATTAGTAGCGTAACTGTAACAAATGTATTT
ATTGTATCGCGTCGAGGTAAAATTTTAGGATCGAGTCTAAATGAATTATTAAAAAGTCAA
AGAATTATTCAAATGTTGGAAGAAAGACATATTCCAAGTGAATATACAGAACGATTAATG
GAAGTTAAACAAACAGAATCAAATATTGATATCGACAATGTATTAACAGTATTCCCACCT
GAAAACAGAGAATTATTCATAGATAGTCGTACAACTATCTTCCCAATTTTAGGTGGAGGG
GAAAGATTAGGTACATTAGTACTTGGTCGAGTACATGATGATTTTAATGAAAATGATTTG
GTACTAGGTGAATATGCTGCTACAGTTATTGGTATGGAAATCTTACGTGAGAAGCATAGT
GAAGTAGAAAAAGAAGCGCGCGATAAAGCTGCTATTACAATGGCAATTAATTCATTATCT
TATTCTGAAAAAGAAGCGATTGAACATATCTTTGAAGAACTTGGCGGTACGGAAGGCCTA
TTAATCGCATCAAAAGTTGCAGATAGAGTTGGTATTACTAGATCTGTAATTGTAAATGCA
CTACGTAAATTAGAAAGTGCTGGTGTAATTGAATCACGTTCTTTAGGAATGAAAGGTACT
TTCATTAAAGTTAAAAAAGAAAAATTCTTAGATGAATTAGAAAAAAGTAAATAA60
120
180
240
300
360
420
480
540
600
660
720
774
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL1272 [new locus tag: SACOL_RS06495 ]
- symbol: CodY
- description: transcriptional repressor CodY
- length: 257
- theoretical pI: 6.07842
- theoretical MW: 28754.9
- GRAVY: -0.178599
⊟Function[edit | edit source]
- TIGRFAM: Regulatory functions DNA interactions GTP-sensing transcriptional pleiotropic repressor CodY (TIGR02787; HMM-score: 351.8)and 3 moreRegulatory functions DNA interactions CRISPR locus-related DNA-binding protein (TIGR01884; HMM-score: 20.1)RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 15.4)Unknown function General Rrf2 family protein (TIGR00738; HMM-score: 14.3)
- TheSEED :
- GTP-sensing transcriptional pleiotropic repressor CodY
- PFAM: GAF (CL0161) CodY; CodY GAF-like domain (PF06018; HMM-score: 234.2)and 21 moreHTH (CL0123) HTH_CodY; CodY helix-turn-helix domain (PF08222; HMM-score: 104.6)Ribosomal_S25; S25 ribosomal protein (PF03297; HMM-score: 23.4)HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 20.3)GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 18.3)HTH_11; HTH domain (PF08279; HMM-score: 17.8)HTH_20; Helix-turn-helix domain (PF12840; HMM-score: 17.4)TrmB; Sugar-specific transcriptional regulator TrmB (PF01978; HMM-score: 17.2)Rrf2; Iron-dependent Transcriptional regulator (PF02082; HMM-score: 16.9)MarR_2; MarR family (PF12802; HMM-score: 16.9)GAF (CL0161) GAF_2; GAF domain (PF13185; HMM-score: 16.3)HTH (CL0123) MarR; MarR family (PF01047; HMM-score: 15.4)HTH_27; Winged helix DNA-binding domain (PF13463; HMM-score: 15.3)DUF4423; Domain of unknown function (DUF4423) (PF14394; HMM-score: 15.3)HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 15.1)SoFic-like_C; Protein adenylyltransferase SoFic-like, C-terminal domain (PF21248; HMM-score: 13.7)GAF (CL0161) GAF; GAF domain (PF01590; HMM-score: 13.3)HTH (CL0123) HTH_41; Helix-turn-helix domain (PF14502; HMM-score: 13.3)HTH_8; Bacterial regulatory protein, Fis family (PF02954; HMM-score: 12.5)no clan defined Coa3_cc; Cytochrome c oxidase assembly factor 3 (PF09813; HMM-score: 12.5)HTH (CL0123) HxlR; HxlR-like helix-turn-helix (PF01638; HMM-score: 12.1)DUF7343; Domain of unknown function (DUF7343) (PF24034; HMM-score: 10.6)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors: Branched-chain amino acids; GTP
- genes regulated by CodY, TF important in Amino acid metabolismRegPrecise and [1]transcription units transferred from N315 data RegPreciserepressionmetX*butA*cap5A > cap5B > cap5C > cap5D > cap5E > cap5F > cap5G > cap5H > cap5I > cap5J > cap5K > cap5L > cap5M > cap5N > cap5O > cap5PparB*nfrA*tcyP*dtpT*patA*lipM*nrgA*bcaP*
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9663
- Cytoplasmic Membrane Score: 0.0296
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.004
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.001202
- TAT(Tat/SPI): 0.000369
- LIPO(Sec/SPII): 0.000274
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSLLSKTRELNTLLQKHKGIAVDFKDVAQTISSVTVTNVFIVSRRGKILGSSLNELLKSQRIIQMLEERHIPSEYTERLMEVKQTESNIDIDNVLTVFPPENRELFIDSRTTIFPILGGGERLGTLVLGRVHDDFNENDLVLGEYAATVIGMEILREKHSEVEKEARDKAAITMAINSLSYSEKEAIEHIFEELGGTEGLLIASKVADRVGITRSVIVNALRKLESAGVIESRSLGMKGTFIKVKKEKFLDELEKSK
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [2] [3] [4] [5]
- quantitative data / protein copy number per cell: 1874 [6]
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: xerC > hslV > hslU > codY
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Arnab Basu, Kathryn E Shields, Christopher S Eickhoff, Daniel F Hoft, M N Yap
Thermal and Nutritional Regulation of Ribosome Hibernation in Staphylococcus aureus.
J Bacteriol: 2018, 200(24);
[PubMed:30297357] [WorldCat.org] [DOI] (I e) - ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
J Proteome Res: 2010, 9(3);1579-90
[PubMed:20108986] [WorldCat.org] [DOI] (I p) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e)

