From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1272 [new locus tag: SACOL_RS06495 ]
  • pan locus tag?: SAUPAN003553000
  • symbol: codY
  • pan gene symbol?: codY
  • synonym:
  • product: transcriptional repressor CodY

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1272 [new locus tag: SACOL_RS06495 ]
  • symbol: codY
  • product: transcriptional repressor CodY
  • replicon: chromosome
  • strand: +
  • coordinates: 1283471..1284244
  • length: 774
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAGCTTATTATCTAAAACGAGAGAGTTAAACACGTTACTTCAAAAACACAAAGGTATT
    GCGGTTGATTTTAAAGATGTAGCACAAACGATTAGTAGCGTAACTGTAACAAATGTATTT
    ATTGTATCGCGTCGAGGTAAAATTTTAGGATCGAGTCTAAATGAATTATTAAAAAGTCAA
    AGAATTATTCAAATGTTGGAAGAAAGACATATTCCAAGTGAATATACAGAACGATTAATG
    GAAGTTAAACAAACAGAATCAAATATTGATATCGACAATGTATTAACAGTATTCCCACCT
    GAAAACAGAGAATTATTCATAGATAGTCGTACAACTATCTTCCCAATTTTAGGTGGAGGG
    GAAAGATTAGGTACATTAGTACTTGGTCGAGTACATGATGATTTTAATGAAAATGATTTG
    GTACTAGGTGAATATGCTGCTACAGTTATTGGTATGGAAATCTTACGTGAGAAGCATAGT
    GAAGTAGAAAAAGAAGCGCGCGATAAAGCTGCTATTACAATGGCAATTAATTCATTATCT
    TATTCTGAAAAAGAAGCGATTGAACATATCTTTGAAGAACTTGGCGGTACGGAAGGCCTA
    TTAATCGCATCAAAAGTTGCAGATAGAGTTGGTATTACTAGATCTGTAATTGTAAATGCA
    CTACGTAAATTAGAAAGTGCTGGTGTAATTGAATCACGTTCTTTAGGAATGAAAGGTACT
    TTCATTAAAGTTAAAAAAGAAAAATTCTTAGATGAATTAGAAAAAAGTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    774


Protein[edit | edit source]

Protein Data Bank: 5EY0
Protein Data Bank: 5EY1

General[edit | edit source]

  • locus tag: SACOL1272 [new locus tag: SACOL_RS06495 ]
  • symbol: CodY
  • description: transcriptional repressor CodY
  • length: 257
  • theoretical pI: 6.07842
  • theoretical MW: 28754.9
  • GRAVY: -0.178599

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions GTP-sensing transcriptional pleiotropic repressor CodY (TIGR02787; HMM-score: 351.8)
    and 3 more
    Signal transduction Regulatory functions DNA interactions CRISPR locus-related DNA-binding protein (TIGR01884; HMM-score: 20.1)
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 15.4)
    Unknown function General Rrf2 family protein (TIGR00738; HMM-score: 14.3)
  • TheSEED  :
    • GTP-sensing transcriptional pleiotropic repressor CodY
    Conserved gene cluster associated with Met-tRNA formyltransferase  GTP-sensing transcriptional pleiotropic repressor codY
  • PFAM:
    GAF (CL0161) CodY; CodY GAF-like domain (PF06018; HMM-score: 234.2)
    and 21 more
    HTH (CL0123) HTH_CodY; CodY helix-turn-helix domain (PF08222; HMM-score: 104.6)
    Ribosomal_S25; S25 ribosomal protein (PF03297; HMM-score: 23.4)
    HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 20.3)
    GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 18.3)
    HTH_11; HTH domain (PF08279; HMM-score: 17.8)
    HTH_20; Helix-turn-helix domain (PF12840; HMM-score: 17.4)
    TrmB; Sugar-specific transcriptional regulator TrmB (PF01978; HMM-score: 17.2)
    Rrf2; Iron-dependent Transcriptional regulator (PF02082; HMM-score: 16.9)
    MarR_2; MarR family (PF12802; HMM-score: 16.9)
    GAF (CL0161) GAF_2; GAF domain (PF13185; HMM-score: 16.3)
    HTH (CL0123) MarR; MarR family (PF01047; HMM-score: 15.4)
    HTH_27; Winged helix DNA-binding domain (PF13463; HMM-score: 15.3)
    DUF4423; Domain of unknown function (DUF4423) (PF14394; HMM-score: 15.3)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 15.1)
    SoFic-like_C; Protein adenylyltransferase SoFic-like, C-terminal domain (PF21248; HMM-score: 13.7)
    GAF (CL0161) GAF; GAF domain (PF01590; HMM-score: 13.3)
    HTH (CL0123) HTH_41; Helix-turn-helix domain (PF14502; HMM-score: 13.3)
    HTH_8; Bacterial regulatory protein, Fis family (PF02954; HMM-score: 12.5)
    no clan defined Coa3_cc; Cytochrome c oxidase assembly factor 3 (PF09813; HMM-score: 12.5)
    HTH (CL0123) HxlR; HxlR-like helix-turn-helix (PF01638; HMM-score: 12.1)
    DUF7343; Domain of unknown function (DUF7343) (PF24034; HMM-score: 10.6)

Structure, modifications & cofactors[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9663
    • Cytoplasmic Membrane Score: 0.0296
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.004
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.001202
    • TAT(Tat/SPI): 0.000369
    • LIPO(Sec/SPII): 0.000274
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MSLLSKTRELNTLLQKHKGIAVDFKDVAQTISSVTVTNVFIVSRRGKILGSSLNELLKSQRIIQMLEERHIPSEYTERLMEVKQTESNIDIDNVLTVFPPENRELFIDSRTTIFPILGGGERLGTLVLGRVHDDFNENDLVLGEYAATVIGMEILREKHSEVEKEARDKAAITMAINSLSYSEKEAIEHIFEELGGTEGLLIASKVADRVGITRSVIVNALRKLESAGVIESRSLGMKGTFIKVKKEKFLDELEKSK

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [2] [3] [4] [5]
  • quantitative data / protein copy number per cell: 1874 [6]
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Arnab Basu, Kathryn E Shields, Christopher S Eickhoff, Daniel F Hoft, M N Yap
    Thermal and Nutritional Regulation of Ribosome Hibernation in Staphylococcus aureus.
    J Bacteriol: 2018, 200(24);
    [PubMed:30297357] [WorldCat.org] [DOI] (I e)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J Proteome Res: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  4. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  5. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  6. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]