From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1022 [new locus tag: SACOL_RS05215 ]
  • pan locus tag?: SAUPAN003195000
  • symbol: ypfP
  • pan gene symbol?: ugtP
  • synonym:
  • product: diacylglycerol glucosyltransferase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1022 [new locus tag: SACOL_RS05215 ]
  • symbol: ypfP
  • product: diacylglycerol glucosyltransferase
  • replicon: chromosome
  • strand: -
  • coordinates: 1030485..1031660
  • length: 1176
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    ATGGTTACTCAAAATAAAAAGATATTGATTATTACTGGCTCATTCGGTAACGGTCATATG
    CAAGTTACACAGAGTATCGTTAATCAACTTAATGATATGAATCTAGACCATTTAAGCGTC
    ATTGAGCACGATTTATTTATGGAAGCTCATCCAATTTTGACTTCTATTTGTAAAAAATGG
    TATATCAATAGCTTTAAATATTTTAGAAATATGTACAAAGGGTTTTATTACAGCCGCCCA
    GATAAACTAGACAAATGTTTTTACAAATACTATGGACTTAATAAGTTAATTAATTTATTG
    ATAAAAGAAAAGCCAGATTTAATATTATTAACGTTTCCTACACCAGTTATGTCGGTACTA
    ACTGAGCAATTTAACATTAATATTCCAGTTGCTACAGTGATGACAGACTATCGCTTACAT
    AAAAACTGGATTACGCCGTATTCAACAAGATATTATGTGGCAACAAAAGAAACGAAACAA
    GACTTCATAGACGTAGGTATTGATCCTTCAACAGTTAAAGTGACAGGTATTCCTATTGAT
    AACAAATTTGAAACGCCTATTAATCAAAAGCAGTGGTTAATAGACAACAACTTAGATCCA
    GATAAGCAAACTATTTTAATGTCAGCTGGTGCATTTGGTGTATCTAAAGGTTTTGACACG
    ATGATTACTGATATATTAGCGAAAAGTGCAAATGCACAAGTAGTTATGATTTGTGGTAAG
    AGCAAAGAGCTAAAGCGTTCTTTAACAGCTAAGTTTAAATCTAACGAGAATGTATTGATT
    CTAGGTTATACCAAACACATGAATGAATGGATGGCATCAAGTCAACTTATGATTACGAAA
    CCTGGTGGTATCACAATAACTGAAGGTTTCGCCCGTTGTATTCCAATGATTTTCCTAAAT
    CCTGCACCTGGTCAAGAGCTTGAAAATGCCCTTTACTTTGAAGAAAAAGGTTTTGGTAAA
    ATCGCTGATACTCCAGAAGAAGCAATAAAAATTGTAGCAAGTTTAACTAACGGTAATGAG
    CAATTAACTAACATGATTAGTACAATGGAACAAGATAAAATTAAGTATGCTACACAGACA
    ATATGTCGAGACTTACTTGATTTAATCGGTCATTCATCACAACCACAAGAGATTTATGGA
    AAGGTTCCTTTATATGCAAGATTCTTCGTTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1176

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1022 [new locus tag: SACOL_RS05215 ]
  • symbol: YpfP
  • description: diacylglycerol glucosyltransferase
  • length: 391
  • theoretical pI: 8.60534
  • theoretical MW: 44547.5
  • GRAVY: -0.180563

Function[edit | edit source]

  • reaction:
    EC 2.4.1.315?  ExPASy
    Diglucosyl diacylglycerol synthase (1,6-linking) UDP-alpha-D-glucose + 1,2-diacyl-3-O-(beta-D-glucopyranosyl)-sn-glycerol = 1,2-diacyl-3-O-(beta-D-glucopyranosyl-(1->6)-O-beta-D-glucopyranosyl)-sn-glycerol + UDP UDP-alpha-D-glucose + 1,2-diacyl-3-O-(beta-D-glucopyranosyl-(1->6)-O-beta-D-glucopyranosyl)-sn-glycerol = 1,2-diacyl-3-O-(beta-D-glucopyranosyl-(1->6)-beta-D-glucopyranosyl-(1->6)-O-beta-D-glucopyranosyl)-sn-glycerol + UDP UDP-glucose + 1,2-diacyl-sn-glycerol = UDP + 1,2-diacyl-3-O-(beta-D-glucopyranosyl)-sn-glycerol?
  • TIGRFAM:
    Cell structure Cell envelope Biosynthesis and degradation of murein sacculus and peptidoglycan undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase (TIGR01133; EC 2.4.1.227; HMM-score: 41.9)
    and 3 more
    UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase (TIGR03590; EC 3.6.1.57; HMM-score: 23.5)
    Hypothetical proteins Conserved conserved hypothetical protein (TIGR00661; HMM-score: 20.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Glutathione and analogs N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA (TIGR03999; EC 2.4.1.-; HMM-score: 11.5)
  • TheSEED:  
    Cell Wall and Capsule Gram-Positive cell wall components Teichoic and lipoteichoic acids biosynthesis  diglucosyldiacylglycerol synthase (LTA membrane anchor synthesis)
  • PFAM:
    GT-B (CL0113) MGDG_synth; Monogalactosyldiacylglycerol (MGDG) synthase (PF06925; HMM-score: 162.4)
    and 4 more
    Glyco_tran_28_C; Glycosyltransferase family 28 C-terminal domain (PF04101; HMM-score: 40.6)
    Glycos_transf_1; Glycosyl transferases group 1 (PF00534; HMM-score: 33)
    Glyco_trans_1_4; Glycosyl transferases group 1 (PF13692; HMM-score: 22.7)
    Epimerase_2; UDP-N-acetylglucosamine 2-epimerase (PF02350; HMM-score: 19.5)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.011009
    • TAT(Tat/SPI): 0.000161
    • LIPO(Sec/SPII): 0.002461
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MVTQNKKILIITGSFGNGHMQVTQSIVNQLNDMNLDHLSVIEHDLFMEAHPILTSICKKWYINSFKYFRNMYKGFYYSRPDKLDKCFYKYYGLNKLINLLIKEKPDLILLTFPTPVMSVLTEQFNINIPVATVMTDYRLHKNWITPYSTRYYVATKETKQDFIDVGIDPSTVKVTGIPIDNKFETPINQKQWLIDNNLDPDKQTILMSAGAFGVSKGFDTMITDILAKSANAQVVMICGKSKELKRSLTAKFKSNENVLILGYTKHMNEWMASSQLMITKPGGITITEGFARCIPMIFLNPAPGQELENALYFEEKGFGKIADTPEEAIKIVASLTNGNEQLTNMISTMEQDKIKYATQTICRDLLDLIGHSSQPQEIYGKVPLYARFFVK

Experimental data[edit | edit source]

  • experimental localization: Cytoplasmic [1] [2]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]

P Jorasch, D C Warnecke, B Lindner, U Zähringer, E Heinz
Novel processive and nonprocessive glycosyltransferases from Staphylococcus aureus and Arabidopsis thaliana synthesize glycoglycerolipids, glycophospholipids, glycosphingolipids and glycosylsterols.
Eur J Biochem: 2000, 267(12);3770-83
[PubMed:10848996] [WorldCat.org] [DOI] (P p)
A M Ludovice, S W Wu, H de Lencastre
Molecular cloning and DNA sequencing of the Staphylococcus aureus UDP-N-acetylmuramyl tripeptide synthetase (murE) gene, essential for the optimal expression of methicillin resistance.
Microb Drug Resist: 1998, 4(2);85-90
[PubMed:9650993] [WorldCat.org] [DOI] (P p)