Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL_RS08870 [old locus tag: SACOL1735 ]
- pan locus tag?: SAUPAN004310000
- symbol: SACOL_RS08870
- pan gene symbol?: coaE
- synonym:
- product: dephospho-CoA kinase
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL_RS08870 [old locus tag: SACOL1735 ]
- symbol: SACOL_RS08870
- product: dephospho-CoA kinase
- replicon: chromosome
- strand: -
- coordinates: 1766262..1766885
- length: 624
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NC_002951 (1766262..1766885) NCBI
- BioCyc: SACOL_RS08870 BioCyc
- MicrobesOnline: see SACOL1735
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601ATGCCGAAAGTTATTGGTCTAACAGGTGGAATCGCCTCAGGAAAATCAACAGTATCAGAA
CTCTTATCCGTATTCGGTTTTAAAGTAGTAGATGCTGATAAAGCAGCCAGGGAAGCTGTT
AAAAAGGGGAGTAAAGGTTTAGCTCAAGTACGAGAAGTCTTTGGTGATGAAGCAATTGAT
GAAAATGGTGAGATGAATCGTCGTTATATGGGTGATCTAGTGTTTAATCATCCAGAAAAA
CGCTTAGAATTAAATGCTATCATACATCCTATCGTGCGAGATATTATGGAAGAAGAAAAG
CAAGAATATTTAAAACAAGGATATAATGTAATCATGGATATTCCATTATTATTTGAAAAT
GAATTGGAAAATACAGTAGACGAAGTGTGGGTTGTATACACTTCTGAAAGTATACAAATG
GATCGTTTAATGCAACGTAATAATTTGTCATTAGAAGATGCGAAAGCACGTGTCTATAGC
CAAATTTCTATTGATAAAAAAAGCCGAATGGCCGATCATGTTATCGATAATTTAGGGGAT
AAACTTGAATTAAAACAAAACCTTGAGAGATTGTTAGAAGAAGAAGGTTATATTGAAAAG
CCGAATTACGGAGAAGAAGATTAA60
120
180
240
300
360
420
480
540
600
624
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL_RS08870 [old locus tag: SACOL1735 ]
- symbol: SACOL_RS08870
- description: dephospho-CoA kinase
- length: 207
- theoretical pI: 4.47247
- theoretical MW: 23622.6
- GRAVY: -0.518358
⊟Function[edit | edit source]
- reaction: EC 2.7.1.24? ExPASyDephospho-CoA kinase ATP + 3'-dephospho-CoA = ADP + CoA
- TIGRFAM: Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 195.3)
- TheSEED: see SACOL1735
- PFAM: P-loop_NTPase (CL0023) CoaE; Dephospho-CoA kinase (PF01121; HMM-score: 196.6)and 6 moreAAA_33; AAA domain (PF13671; HMM-score: 23)AAA_18; AAA domain (PF13238; HMM-score: 22.3)AAA_17; AAA domain (PF13207; HMM-score: 15.5)AAA_28; AAA domain (PF13521; HMM-score: 15.3)Zeta_toxin; Zeta toxin (PF06414; HMM-score: 14.1)no clan defined Syntaphilin; Golgi-localised syntaxin-1-binding clamp (PF15290; HMM-score: 13.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9971
- Cytoplasmic Membrane Score: 0.0008
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.002
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.042425
- TAT(Tat/SPI): 0.003634
- LIPO(Sec/SPII): 0.007542
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MPKVIGLTGGIASGKSTVSELLSVFGFKVVDADKAAREAVKKGSKGLAQVREVFGDEAIDENGEMNRRYMGDLVFNHPEKRLELNAIIHPIVRDIMEEEKQEYLKQGYNVIMDIPLLFENELENTVDEVWVVYTSESIQMDRLMQRNNLSLEDAKARVYSQISIDKKSRMADHVIDNLGDKLELKQNLERLLEEEGYIEKPNYGEED
⊟Experimental data[edit | edit source]
- experimentally validated: see SACOL1735
- protein localization: see SACOL1735
- quantitative data / protein copy number per cell: see SACOL1735
- interaction partners:
SACOL_RS01135 L-lactate dehydrogenase [1] (data from MRSA252) SACOL_RS02640 YbaB/EbfC family nucleoid-associated protein [1] (data from MRSA252) SACOL_RS02850 cysteine synthase [1] (data from MRSA252) SACOL_RS03020 transcription termination/antitermination protein NusG [1] (data from MRSA252) SACOL_RS03035 50S ribosomal protein L10 [1] (data from MRSA252) SACOL_RS03070 30S ribosomal protein S7 [1] (data from MRSA252) SACOL_RS03415 zinc-dependent alcohol dehydrogenase [1] (data from MRSA252) SACOL_RS04080 ribonucleotide-diphosphate reductase subunit beta [1] (data from MRSA252) SACOL_RS04330 enolase [1] (data from MRSA252) SACOL_RS04950 glucose-6-phosphate isomerase [1] (data from MRSA252) SACOL_RS05470 bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase [1] (data from MRSA252) SACOL_RS06505 30S ribosomal protein S2 [1] (data from MRSA252) SACOL_RS06770 glutamine synthetase [1] (data from MRSA252) SACOL_RS06965 catalase [1] (data from MRSA252) SACOL_RS07530 alanine dehydrogenase [1] (data from MRSA252) SACOL_RS07920 phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating) [1] (data from MRSA252) SACOL_RS08270 glycine--tRNA ligase [1] (data from MRSA252) SACOL_RS08345 molecular chaperone DnaK [1] (data from MRSA252) SACOL_RS08495 transcription elongation factor GreA [1] (data from MRSA252) SACOL_RS08930 pyruvate kinase [1] (data from MRSA252) SACOL_RS09045 30S ribosomal protein S4 [1] (data from MRSA252) SACOL_RS10410 thioredoxin family protein [1] (data from MRSA252) SACOL_RS11090 DNA-directed RNA polymerase subunit delta [1] (data from MRSA252) SACOL_RS11615 30S ribosomal protein S9 [1] (data from MRSA252) SACOL_RS11660 30S ribosomal protein S13 [1] (data from MRSA252) SACOL_RS11675 adenylate kinase [1] (data from MRSA252) SACOL_RS11695 30S ribosomal protein S5 [1] (data from MRSA252) SACOL_RS11755 50S ribosomal protein L22 [1] (data from MRSA252) SACOL_RS11765 50S ribosomal protein L2 [1] (data from MRSA252) SACOL_RS13365 pyruvate oxidase [1] (data from MRSA252) SACOL_RS13415 hydroxymethylglutaryl-CoA synthase [1] (data from MRSA252) SACOL_RS13725 malate:quinone oxidoreductase [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)