Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL1735 [new locus tag: SACOL_RS08870 ]
- pan locus tag?: SAUPAN004310000
- symbol: coaE
- pan gene symbol?: coaE
- synonym:
- product: dephospho-CoA kinase
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL1735 [new locus tag: SACOL_RS08870 ]
- symbol: coaE
- product: dephospho-CoA kinase
- replicon: chromosome
- strand: -
- coordinates: 1766262..1766885
- length: 624
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3238585 NCBI
- RefSeq: YP_186572 NCBI
- BioCyc: see SACOL_RS08870
- MicrobesOnline: 913181 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601ATGCCGAAAGTTATTGGTCTAACAGGTGGAATCGCCTCAGGAAAATCAACAGTATCAGAA
CTCTTATCCGTATTCGGTTTTAAAGTAGTAGATGCTGATAAAGCAGCCAGGGAAGCTGTT
AAAAAGGGGAGTAAAGGTTTAGCTCAAGTACGAGAAGTCTTTGGTGATGAAGCAATTGAT
GAAAATGGTGAGATGAATCGTCGTTATATGGGTGATCTAGTGTTTAATCATCCAGAAAAA
CGCTTAGAATTAAATGCTATCATACATCCTATCGTGCGAGATATTATGGAAGAAGAAAAG
CAAGAATATTTAAAACAAGGATATAATGTAATCATGGATATTCCATTATTATTTGAAAAT
GAATTGGAAAATACAGTAGACGAAGTGTGGGTTGTATACACTTCTGAAAGTATACAAATG
GATCGTTTAATGCAACGTAATAATTTGTCATTAGAAGATGCGAAAGCACGTGTCTATAGC
CAAATTTCTATTGATAAAAAAAGCCGAATGGCCGATCATGTTATCGATAATTTAGGGGAT
AAACTTGAATTAAAACAAAACCTTGAGAGATTGTTAGAAGAAGAAGGTTATATTGAAAAG
CCGAATTACGGAGAAGAAGATTAA60
120
180
240
300
360
420
480
540
600
624
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL1735 [new locus tag: SACOL_RS08870 ]
- symbol: CoaE
- description: dephospho-CoA kinase
- length: 207
- theoretical pI: 4.47247
- theoretical MW: 23622.6
- GRAVY: -0.518358
⊟Function[edit | edit source]
- reaction: EC 2.7.1.24? ExPASyDephospho-CoA kinase ATP + 3'-dephospho-CoA = ADP + CoA
- TIGRFAM: Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 195.3)
- TheSEED :
- Dephospho-CoA kinase (EC 2.7.1.24)
- PFAM: P-loop_NTPase (CL0023) CoaE; Dephospho-CoA kinase (PF01121; HMM-score: 196.6)and 6 moreAAA_33; AAA domain (PF13671; HMM-score: 23)AAA_18; AAA domain (PF13238; HMM-score: 22.3)AAA_17; AAA domain (PF13207; HMM-score: 15.5)AAA_28; AAA domain (PF13521; HMM-score: 15.3)Zeta_toxin; Zeta toxin (PF06414; HMM-score: 14.1)no clan defined Syntaphilin; Golgi-localised syntaxin-1-binding clamp (PF15290; HMM-score: 13.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9971
- Cytoplasmic Membrane Score: 0.0008
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.002
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.042425
- TAT(Tat/SPI): 0.003634
- LIPO(Sec/SPII): 0.007542
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MPKVIGLTGGIASGKSTVSELLSVFGFKVVDADKAAREAVKKGSKGLAQVREVFGDEAIDENGEMNRRYMGDLVFNHPEKRLELNAIIHPIVRDIMEEEKQEYLKQGYNVIMDIPLLFENELENTVDEVWVVYTSESIQMDRLMQRNNLSLEDAKARVYSQISIDKKSRMADHVIDNLGDKLELKQNLERLLEEEGYIEKPNYGEED
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2] [3]
- quantitative data / protein copy number per cell: 521 [4]
- interaction partners:
SACOL0660 (adhP) alcohol dehydrogenase [5] (data from MRSA252) SACOL2218 (adk) adenylate kinase [5] (data from MRSA252) SACOL1478 (ald1) alanine dehydrogenase [5] (data from MRSA252) SACOL0557 (cysK) cysteine synthase [5] (data from MRSA252) SACOL1637 (dnaK) molecular chaperone DnaK [5] (data from MRSA252) SACOL0842 (eno) phosphopyruvate hydratase [5] (data from MRSA252) SACOL1329 (femC) glutamine synthetase [5] (data from MRSA252) SACOL1072 (folD) bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase [5] (data from MRSA252) SACOL1622 (glyS) glycyl-tRNA synthetase [5] (data from MRSA252) SACOL1554 (gnd) 6-phosphogluconate dehydrogenase [5] (data from MRSA252) SACOL1665 (greA) transcription elongation factor GreA [5] (data from MRSA252) SACOL1368 (kataA) catalase [5] (data from MRSA252) SACOL0222 (ldh1) L-lactate dehydrogenase [5] (data from MRSA252) SACOL2623 (mqo2) malate:quinone oxidoreductase [5] (data from MRSA252) SACOL0793 (nrdF) ribonucleotide-diphosphate reductase subunit beta [5] (data from MRSA252) SACOL0582 (nusG) transcription antitermination protein [5] (data from MRSA252) SACOL0966 (pgi) glucose-6-phosphate isomerase [5] (data from MRSA252) SACOL1745 (pyk) pyruvate kinase [5] (data from MRSA252) SACOL2236 (rplB) 50S ribosomal protein L2 [5] (data from MRSA252) SACOL0585 (rplJ) 50S ribosomal protein L10 [5] (data from MRSA252) SACOL2234 (rplV) 50S ribosomal protein L22 [5] (data from MRSA252) SACOL2120 (rpoE) DNA-directed RNA polymerase subunit delta [5] (data from MRSA252) SACOL1274 (rpsB) 30S ribosomal protein S2 [5] (data from MRSA252) SACOL1769 (rpsD) 30S ribosomal protein S4 [5] (data from MRSA252) SACOL2222 (rpsE) 30S ribosomal protein S5 [5] (data from MRSA252) SACOL0592 (rpsG) 30S ribosomal protein S7 [5] (data from MRSA252) SACOL2206 (rpsI) 30S ribosomal protein S9 [5] (data from MRSA252) SACOL2215 (rpsM) 30S ribosomal protein S13 [5] (data from MRSA252) SACOL0521 hypothetical protein [5] (data from MRSA252) SACOL1992 hypothetical protein [5] (data from MRSA252) SACOL2553 pyruvate oxidase [5] (data from MRSA252) SACOL2561 hydroxymethylglutaryl-CoA synthase [5] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: coaE < fpg < polA
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: 19.76 h [6]
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e) - ↑ 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 5.15 5.16 5.17 5.18 5.19 5.20 5.21 5.22 5.23 5.24 5.25 5.26 5.27 5.28 5.29 5.30 5.31 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
Mol Cell Proteomics: 2012, 11(9);558-70
[PubMed:22556279] [WorldCat.org] [DOI] (I p)
