From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01734
  • pan locus tag?: SAUPAN004230000
  • symbol: SAOUHSC_01734
  • pan gene symbol?: rarA
  • synonym:
  • product: recombination factor protein RarA

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01734
  • symbol: SAOUHSC_01734
  • product: recombination factor protein RarA
  • replicon: chromosome
  • strand: +
  • coordinates: 1636639..1637913
  • length: 1275
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    GTGAGTACAGAACCATTAGCATCGAGAATGCGCCCAAAAAATATAGATGAAATCATTTCC
    CAACAACATTTAGTTGGACCAAGAGGCATTATCAGAAGAATGGTTGATACAAAAAAATTA
    ACTTCAATGATTTTTTATGGTCCACCTGGTATAGGCAAAACAAGTATTGCCAAAGCAATT
    TCGGGCAGTACGCAATATAAATTCAGACAATTGAATGCTGTAACTAACACTAAAAAAGAT
    ATGCAACTTGTTGTTGAAGAAGCTAAAATGTCTGGTCAAGTTATCTTGTTATTAGATGAA
    ATACATCGACTAGATAAAGCTAAACAAGACTTTTTATTACCTCATTTAGAAAATGGCAAA
    ATCGTCTTGATCGGTGCTACAACTTCAAATCCTTATCATGCTATCAATCCAGCGATTCGT
    TCAAGAGCGCAAATTTTCGAGTTATATCCTTTAAATGACGAAGATGTGCGCCAAGCGTTA
    ACTCGTGCAATAGAAGATGATGAGAATGGTTTGAAAACATATCAACCCAAAATTGATGAA
    GATGCCATGACCTACTTTTCTACACAAAGCCAAGGTGATGTTCGTAGTGCGTTAAATGCA
    TTGGAATTAGCTGTATTAAGCGCAGATAATGACAAAGACGGTTATCGACATGTTACATTG
    CAAGATGCTAAAGACTGTTTACAAAAAGGTGCATTTGTAAGTGACAAGGATGGTGACATG
    CATTACGATGTTATGAGCGCTTTCCAAAAATCTATCCGTGGTAGCGACGTCAATGCCGCT
    TTACATTATTTAGCACGATTAATTGAAGCTGGAGATTTACCTACAATAGTTCGACGATTA
    CTTGTAATTAGCTATGAGGATATAGGCTTAGCCTCACCTAATGCTGGTCAGAGAACACTT
    GCTGCTATTGAATCAGCAGAACGTCTAGGTTTACCAGAAGCTAGAATTCCACTAAGCCAA
    GCAGTAATCGAACTATGCTTATCACCTAAGTCAAATTCAGCAATGAGTGCCATTGATAGT
    GCATTGTCCGATATTAGAAACGGTCATGTGGGCCAAATTCCAAACCATTTAAAAGATGGA
    CATTATCAAGGTGCTAAAGATCTAGGCCGATCTATTGGTTACAAATATCCACACCAATAT
    GTTAATGGCTATGTTTCACAGCAATATTTACCTGATAAACTAAAAAACAAAATTTATTAC
    GAACCAAAAACGACATCTAAAAGTGAACAACAACTCAAAGAAATATATAACAACTTACTT
    AAACAAAGGCCGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1275

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_01734
  • symbol: SAOUHSC_01734
  • description: recombination factor protein RarA
  • length: 424
  • theoretical pI: 8.51483
  • theoretical MW: 47250.5
  • GRAVY: -0.452123

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 68.7)
    and 26 more
    Cellular processes Cellular processes Sporulation and germination ATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 47.7)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 47.7)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 45.1)
    Cellular processes Cellular processes Sporulation and germination ATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 34.7)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 34.7)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA polymerase III, delta' subunit (TIGR00678; EC 2.7.7.7; HMM-score: 34)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DnaA regulatory inactivator Hda (TIGR03420; HMM-score: 30.4)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair orc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 25.6)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease ATP-binding subunit ClpA (TIGR02639; HMM-score: 25.1)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides endopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 23.6)
    Genetic information processing Protein fate Protein folding and stabilization ATP-dependent chaperone protein ClpB (TIGR03346; HMM-score: 20.8)
    AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 19.9)
    Cellular processes Cellular processes Cell division ATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 18.7)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 18.7)
    26S proteasome subunit P45 family (TIGR01242; HMM-score: 18.5)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides proteasome ATPase (TIGR03689; EC 3.6.4.8; HMM-score: 18)
    putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 16.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 16)
    Genetic information processing Mobile and extrachromosomal element functions Prophage functions phage nucleotide-binding protein (TIGR01618; HMM-score: 14.9)
    Cellular processes Cellular processes Sporulation and germination stage V sporulation protein K (TIGR02881; HMM-score: 14.9)
    Cellular processes Cellular processes Other gas vesicle protein GvpN (TIGR02640; HMM-score: 14.8)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair checkpoint protein rad24 (TIGR00602; HMM-score: 13.9)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA replication and repair protein RecF (TIGR00611; HMM-score: 13.9)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions adenylate kinase (TIGR01351; EC 2.7.4.-; HMM-score: 12.9)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides putative ATP-dependent protease (TIGR00764; HMM-score: 12.4)
    Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 11.7)
  • TheSEED:  
    Uncharacterized ATPase (AAA family) associated with cysteine desulfurase
  • PFAM:
    post-AAA (CL0604) MgsA_C; MgsA AAA+ ATPase C terminal (PF12002; HMM-score: 216.6)
    and 26 more
    no clan defined AAA_assoc_2; AAA C-terminal domain (PF16193; HMM-score: 85.6)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 61.4)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 51.4)
    AAA_14; AAA domain (PF13173; HMM-score: 28.6)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 28.4)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 25.6)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 24.5)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 20.8)
    DNA_pol3_delta2; DNA polymerase III, delta subunit (PF13177; HMM-score: 20.6)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 19.8)
    AAA_22; AAA domain (PF13401; HMM-score: 19.6)
    ABC_tran; ABC transporter (PF00005; HMM-score: 19.3)
    Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 19.3)
    Rad17; Rad17 cell cycle checkpoint protein (PF03215; HMM-score: 17.8)
    AAA_18; AAA domain (PF13238; HMM-score: 16.7)
    AAA_19; AAA domain (PF13245; HMM-score: 16.6)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 15.8)
    AAA_3; ATPase family associated with various cellular activities (AAA) (PF07726; HMM-score: 15.5)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 14.1)
    AAA_24; AAA domain (PF13479; HMM-score: 14.1)
    no clan defined LXG; LXG domain of WXG superfamily (PF04740; HMM-score: 14)
    P-loop_NTPase (CL0023) Parvo_NS1; Parvovirus non-structural protein NS1 (PF01057; HMM-score: 13.8)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 13.1)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 13)
    AAA_2; AAA domain (Cdc48 subfamily) (PF07724; HMM-score: 12.7)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 12.3)

Structure, modifications & interactions[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.010866
    • TAT(Tat/SPI): 0.004874
    • LIPO(Sec/SPII): 0.000653
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MSTEPLASRMRPKNIDEIISQQHLVGPRGIIRRMVDTKKLTSMIFYGPPGIGKTSIAKAISGSTQYKFRQLNAVTNTKKDMQLVVEEAKMSGQVILLLDEIHRLDKAKQDFLLPHLENGKIVLIGATTSNPYHAINPAIRSRAQIFELYPLNDEDVRQALTRAIEDDENGLKTYQPKIDEDAMTYFSTQSQGDVRSALNALELAVLSADNDKDGYRHVTLQDAKDCLQKGAFVSDKDGDMHYDVMSAFQKSIRGSDVNAALHYLARLIEAGDLPTIVRRLLVISYEDIGLASPNAGQRTLAAIESAERLGLPEARIPLSQAVIELCLSPKSNSAMSAIDSALSDIRNGHVGQIPNHLKDGHYQGAKDLGRSIGYKYPHQYVNGYVSQQYLPDKLKNKIYYEPKTTSKSEQQLKEIYNNLLKQRP

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • SAOUHSC_01734 no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  4. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]