Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_0440 [new locus tag: SAUSA300_RS02355 ]
- pan locus tag?: SAUPAN002181000
- symbol: SAUSA300_0440
- pan gene symbol?: —
- synonym:
- product: MutT/nudix family protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_0440 [new locus tag: SAUSA300_RS02355 ]
- symbol: SAUSA300_0440
- product: MutT/nudix family protein
- replicon: chromosome
- strand: +
- coordinates: 493286..493681
- length: 396
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3913173 NCBI
- RefSeq: YP_493153 NCBI
- BioCyc: see SAUSA300_RS02355
- MicrobesOnline: 1291955 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGATTAAATGTGTCTGTTTAGTTGAAGAAACAGCTGATAAAATATTGCTTGTTCAAGTA
AGGAATCGCGAAAAGTATTATTTCCCGGGTGGTAAAATAGAAGAAGGGGAATCACAAGTA
CACGCGCTGTTAAGAGAAGTAAAAGAAGAATTAAATTTAACATTAACAATGGATGAAATT
GAATATGTCGGGACAATTGTAGGTCCTGCATATCCACAACAGGATATGTTAACTGAGTTA
AATGGATTTCGCGCATTAACCAAAATCGATTGGGAAAACGTAACTATCAATAATGAAATT
ACGGATATACGCTGGATTGATAAAGATAATGATGCGTTGATTGCGCCTGCTGTCAAAGTT
TGGATTGAAACTTATGGTGGTAAACATGACAAATAA60
120
180
240
300
360
396
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_0440 [new locus tag: SAUSA300_RS02355 ]
- symbol: SAUSA300_0440
- description: MutT/nudix family protein
- length: 131
- theoretical pI: 4.42501
- theoretical MW: 15053.1
- GRAVY: -0.317557
⊟Function[edit | edit source]
- reaction: EC 3.6.1.-? ExPASy
- TIGRFAM: DNA metabolism DNA replication, recombination, and repair nucleoside triphosphatase YtkD (TIGR02705; EC 3.6.1.-; HMM-score: 32)DNA metabolism DNA replication, recombination, and repair mutator mutT protein (TIGR00586; EC 3.6.1.-; HMM-score: 30.4)and 1 moreBiosynthesis of cofactors, prosthetic groups, and carriers Other isopentenyl-diphosphate delta-isomerase (TIGR02150; EC 5.3.3.2; HMM-score: 12.1)
- TheSEED :
- FIG01107849: hypothetical protein
- PFAM: NUDIX (CL0261) NUDIX; NUDIX domain (PF00293; HMM-score: 45.7)and 3 moreNudt16-like; U8 snoRNA-decapping enzyme-like (PF22327; HMM-score: 23.7)NUDIX_2; Nucleotide hydrolase (PF13869; HMM-score: 19.1)NUDIX_4; NUDIX domain (PF14815; HMM-score: 14.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9842
- Cytoplasmic Membrane Score: 0.0042
- Cell wall & surface Score: 0.0005
- Extracellular Score: 0.0111
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.002955
- TAT(Tat/SPI): 0.000237
- LIPO(Sec/SPII): 0.000812
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MIKCVCLVEETADKILLVQVRNREKYYFPGGKIEEGESQVHALLREVKEELNLTLTMDEIEYVGTIVGPAYPQQDMLTELNGFRALTKIDWENVTINNEITDIRWIDKDNDALIAPAVKVWIETYGGKHDK
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]