From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0425 [new locus tag: SA_RS02420 ]
  • pan locus tag?: SAUPAN002181000
  • symbol: SA0425
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA0425 [new locus tag: SA_RS02420 ]
  • symbol: SA0425
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 486548..486943
  • length: 396
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGATTAAATGTGTCTGTTTAGTTGAAGAAACAGCTGATAAAATATTGCTTGTTCAAGTA
    AGGAATCGCGAAAAGTATTATTTCCCAGGTGGTAAAATAGAAGAAGGAGAATCACAAGTA
    CACGCGCTGTTAAGAGAAGTAAAAGAAGAATTAAATTTAACATTAACAATGGATGAAATT
    GAATATATCGGGACAATTGTAGGTCCTGCATATCCACAACAGGATATGTTAACTGAGTTA
    AATGGATTTCGCGCATTAACCAAAATCGATTGGGAAAACGTAACTATCAATAATGAAATT
    ACGGATATACGCTGGATTGATAAAGATAATGATGCGTTGATTGCGCCTGCTGTCAAAGTT
    TGGATTGAAACGTATGGTGGTAAACATGACAAATAA
    60
    120
    180
    240
    300
    360
    396

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA0425 [new locus tag: SA_RS02420 ]
  • symbol: SA0425
  • description: hypothetical protein
  • length: 131
  • theoretical pI: 4.42501
  • theoretical MW: 15067.2
  • GRAVY: -0.315267

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing DNA metabolism DNA replication, recombination, and repair nucleoside triphosphatase YtkD (TIGR02705; EC 3.6.1.-; HMM-score: 32.4)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair mutator mutT protein (TIGR00586; EC 3.6.1.-; HMM-score: 30.5)
    and 1 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other isopentenyl-diphosphate delta-isomerase (TIGR02150; EC 5.3.3.2; HMM-score: 12.4)
  • TheSEED:  
    FIG01107849: hypothetical protein
  • PFAM:
    NUDIX (CL0261) NUDIX; NUDIX domain (PF00293; HMM-score: 44.1)
    and 1 more
    NUDIX_2; Nucleotide hydrolase (PF13869; HMM-score: 20.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002938
    • TAT(Tat/SPI): 0.000219
    • LIPO(Sec/SPII): 0.000815
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MIKCVCLVEETADKILLVQVRNREKYYFPGGKIEEGESQVHALLREVKEELNLTLTMDEIEYIGTIVGPAYPQQDMLTELNGFRALTKIDWENVTINNEITDIRWIDKDNDALIAPAVKVWIETYGGKHDK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]