Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA0425 [new locus tag: SA_RS02420 ]
- pan locus tag?: SAUPAN002181000
- symbol: SA0425
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA0425 [new locus tag: SA_RS02420 ]
- symbol: SA0425
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 486548..486943
- length: 396
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1123210 NCBI
- RefSeq: NP_373677 NCBI
- BioCyc: see SA_RS02420
- MicrobesOnline: 102703 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGATTAAATGTGTCTGTTTAGTTGAAGAAACAGCTGATAAAATATTGCTTGTTCAAGTA
AGGAATCGCGAAAAGTATTATTTCCCAGGTGGTAAAATAGAAGAAGGAGAATCACAAGTA
CACGCGCTGTTAAGAGAAGTAAAAGAAGAATTAAATTTAACATTAACAATGGATGAAATT
GAATATATCGGGACAATTGTAGGTCCTGCATATCCACAACAGGATATGTTAACTGAGTTA
AATGGATTTCGCGCATTAACCAAAATCGATTGGGAAAACGTAACTATCAATAATGAAATT
ACGGATATACGCTGGATTGATAAAGATAATGATGCGTTGATTGCGCCTGCTGTCAAAGTT
TGGATTGAAACGTATGGTGGTAAACATGACAAATAA60
120
180
240
300
360
396
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA0425 [new locus tag: SA_RS02420 ]
- symbol: SA0425
- description: hypothetical protein
- length: 131
- theoretical pI: 4.42501
- theoretical MW: 15067.2
- GRAVY: -0.315267
⊟Function[edit | edit source]
- TIGRFAM: DNA metabolism DNA replication, recombination, and repair nucleoside triphosphatase YtkD (TIGR02705; EC 3.6.1.-; HMM-score: 32.4)DNA metabolism DNA replication, recombination, and repair mutator mutT protein (TIGR00586; EC 3.6.1.-; HMM-score: 30.5)and 1 moreBiosynthesis of cofactors, prosthetic groups, and carriers Other isopentenyl-diphosphate delta-isomerase (TIGR02150; EC 5.3.3.2; HMM-score: 12.4)
- TheSEED :
- Nudix hydrolase-like protein SERP0103
- PFAM: NUDIX (CL0261) NUDIX; NUDIX domain (PF00293; HMM-score: 46.2)and 4 moreNudt16-like; U8 snoRNA-decapping enzyme-like (PF22327; HMM-score: 23.2)NUDIX_2; Nucleotide hydrolase (PF13869; HMM-score: 19)NUDIX_4; NUDIX domain (PF14815; HMM-score: 14.7)P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 12.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9828
- Cytoplasmic Membrane Score: 0.0044
- Cell wall & surface Score: 0.0005
- Extracellular Score: 0.0123
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.002938
- TAT(Tat/SPI): 0.000219
- LIPO(Sec/SPII): 0.000815
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MIKCVCLVEETADKILLVQVRNREKYYFPGGKIEEGESQVHALLREVKEELNLTLTMDEIEYIGTIVGPAYPQQDMLTELNGFRALTKIDWENVTINNEITDIRWIDKDNDALIAPAVKVWIETYGGKHDK
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]