Jump to navigation
Jump to search
NCBI: 06-JUL-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_0431 [new locus tag: NWMN_RS02435 ]
- pan locus tag?: SAUPAN002181000
- symbol: NWMN_0431
- pan gene symbol?: —
- synonym:
- product: MutT domain-containing protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_0431 [new locus tag: NWMN_RS02435 ]
- symbol: NWMN_0431
- product: MutT domain-containing protein
- replicon: chromosome
- strand: +
- coordinates: 482872..483276
- length: 405
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 5330233 NCBI
- RefSeq: YP_001331465 NCBI
- BioCyc:
- MicrobesOnline: 3705962 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361GTGTCAAAGATGATTAAATGTGTCTGTTTAGTTGAAGAAACAGCTGATAAAATATTGCTT
GTTCAAGTAAGGAATCGCGAAAAGTATTATTTCCCGGGTGGTAAAATAGAAGAAGGGGAA
TCACAAGTACACGCGCTGTTAAGAGAAGTAAAAGAAGAATTAAATTTAACATTAACAATG
GATGAAATTGAATATGTCGGGACAATTGTAGGTCCTGCATATCCACAACAGGATATGTTA
ACTGAGTTAAATGGATTTCGCGCATTAACCAAAATCGATTGGGAAAACGTAACTATCAAT
AATGAAATTACGGATATACGCTGGATTGATAAAGATAATGATGCGTTGATTGCGCCTGCT
GTCAAAGTTTGGATTGAAACTTATGGTGGTAAACATGACAAATAA60
120
180
240
300
360
405
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_0431 [new locus tag: NWMN_RS02435 ]
- symbol: NWMN_0431
- description: MutT domain-containing protein
- length: 134
- theoretical pI: 4.51611
- theoretical MW: 15399.6
- GRAVY: -0.331343
⊟Function[edit | edit source]
- TIGRFAM: DNA metabolism DNA replication, recombination, and repair nucleoside triphosphatase YtkD (TIGR02705; EC 3.6.1.-; HMM-score: 32.2)DNA metabolism DNA replication, recombination, and repair mutator mutT protein (TIGR00586; EC 3.6.1.-; HMM-score: 30.4)and 1 moreBiosynthesis of cofactors, prosthetic groups, and carriers Other isopentenyl-diphosphate delta-isomerase (TIGR02150; EC 5.3.3.2; HMM-score: 12)
- TheSEED :
- FIG01107849: hypothetical protein
- PFAM: NUDIX (CL0261) NUDIX; NUDIX domain (PF00293; HMM-score: 45.8)and 3 moreNudt16-like; U8 snoRNA-decapping enzyme-like (PF22327; HMM-score: 23.7)NUDIX_2; Nucleotide hydrolase (PF13869; HMM-score: 20.6)NUDIX_4; NUDIX domain (PF14815; HMM-score: 14.6)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9898
- Cytoplasmic Membrane Score: 0.0027
- Cell wall & surface Score: 0.0004
- Extracellular Score: 0.0071
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.0036
- TAT(Tat/SPI): 0.000107
- LIPO(Sec/SPII): 0.000863
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSKMIKCVCLVEETADKILLVQVRNREKYYFPGGKIEEGESQVHALLREVKEELNLTLTMDEIEYVGTIVGPAYPQQDMLTELNGFRALTKIDWENVTINNEITDIRWIDKDNDALIAPAVKVWIETYGGKHDK
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]