From AureoWiki
Jump to: navigation, search

NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1067 [new locus tag: SAUSA300_RS05790 ]
  • pan locus tag?: SAUPAN003440000
  • symbol: SAUSA300_1067
  • pan gene symbol?: psmβ1
  • synonyms: psmβ1, psmB1
  • product: anti protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_1067 [new locus tag: SAUSA300_RS05790 ]
  • symbol: SAUSA300_1067
  • product: anti protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1168398..1168532
  • length: 135
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    ATGGAAGGTTTATTTAACGCAATTAAAGATACCGTAACTGCAGCAATTAATAATGATGGC
    GCAAAATTAGGCACAAGCATTGTGAGCATCGTTGAAAATGGCGTAGGTTTATTAGGTAAA
    TTATTCGGATTCTAA
    60
    120
    135

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_1067 [new locus tag: SAUSA300_RS05790 ]
  • symbol: SAUSA300_1067
  • description: anti protein
  • length: 44
  • theoretical pI: 4.54462
  • theoretical MW: 4496.17
  • GRAVY: 0.570455

Function[edit source | edit]

  • TIGRFAM:
  • TheSEED:  
    antibacterial protein
  • PFAM:
    no clan definedStaph_haemo; Staphylococcus haemolytic protein (PF05480; HMM-score: 83.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.150184
    • TAT(Tat/SPI): 0.002632
    • LIPO(Sec/SPII): 0.009262
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MEGLFNAIKDTVTAAINNDGAKLGTSIVSIVENGVGLLGKLFGF

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • regulator: AgrA (activation) regulon
    AgrA(TF)important in Virulence, Quorum sensing;  [1] [2]

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Shu Y Queck, Max Jameson-Lee, Amer E Villaruz, Thanh-Huy L Bach, Burhan A Khan, Daniel E Sturdevant, Stacey M Ricklefs, Min Li, Michael Otto
    RNAIII-independent target gene control by the agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus.
    Mol. Cell: 2008, 32(1);150-8
    [PubMed:18851841] [WorldCat.org] [DOI] (I p)
  2. Tobias Geiger, Patrice Francois, Manuel Liebeke, Martin Fraunholz, Christiane Goerke, Bernhard Krismer, Jacques Schrenzel, Michael Lalk, Christiane Wolz
    The stringent response of Staphylococcus aureus and its impact on survival after phagocytosis through the induction of intracellular PSMs expression.
    PLoS Pathog.: 2012, 8(11);e1003016
    [PubMed:23209405] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]

Rong Wang, Kevin R Braughton, Dorothee Kretschmer, Thanh-Huy L Bach, Shu Y Queck, Min Li, Adam D Kennedy, David W Dorward, Seymour J Klebanoff, Andreas Peschel, Frank R DeLeo, Michael Otto
Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA.
Nat. Med.: 2007, 13(12);1510-4
[PubMed:17994102] [WorldCat.org] [DOI] (I p)
Shu Y Queck, Max Jameson-Lee, Amer E Villaruz, Thanh-Huy L Bach, Burhan A Khan, Daniel E Sturdevant, Stacey M Ricklefs, Min Li, Michael Otto
RNAIII-independent target gene control by the agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus.
Mol. Cell: 2008, 32(1);150-8
[PubMed:18851841] [WorldCat.org] [DOI] (I p)
Michael Otto
Staphylococcus aureus toxins.
Curr. Opin. Microbiol.: 2014, 17;32-7
[PubMed:24581690] [WorldCat.org] [DOI] (I p)