PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 10-JUN-2013

⊟Summary

• organism: Staphylococcus aureus USA300_FPR3757
• locus tag: SAUSA300_2175 [new locus tag: SAUSA300_RS12005 ]
• pan locus tag^?: SAUPAN005671000
• symbol: cbiO
• pan gene symbol^?: cbiO2
• synonym: ecfA2
• product: cobalt transporter ATP-binding subunit

⊟Genome View

⊟Gene

⊟General

• type: CDS
• locus tag: SAUSA300_2175 [new locus tag: SAUSA300_RS12005 ]
• symbol: cbiO
• product: cobalt transporter ATP-binding subunit
• replicon: chromosome
• strand: -
• coordinates: 2355234..2356094
• length: 861
• essential: unknown other strains

⊟Accession numbers

• Gene ID: 3915408 NCBI
• RefSeq: YP_494810 NCBI
• BioCyc: see SAUSA300_RS12005
• MicrobesOnline: 1293690 MicrobesOnline

⊟Phenotype

Share your knowledge and add information here. [edit]

⊟DNA sequence

• 1
  61
  121
  181
  241
  301
  361
  421
  481
  541
  601
  661
  721
  781
  841
  
  ATGACTATACGGTTTGACAATGTAAGTTATACCTATCAAAAAGGGACACCATATCAGCAT
  CAAGCTATTCATGATGTTAATACAGAATTTGAACAAGGTAAATATTACGCCATCGTTGGA
  CAAACGGGTAGTGGTAAATCAACGTTGATACAAAATATTAATGCGCTGTTAAAGCCGACT
  ACTGGGACAGTTACAGTTGATGACATTACTATTACACATAAGACCAAAGATAAATATATT
  AGACCTGTAAGAAAAAGAATTGGAATGGTATTTCAATTTCCCGAATCTCAATTATTTGAG
  GACACAGTAGAGCGTGAAATGATATTTGGACCTAAAAACTTTAAAATGAATTTAGATGAA
  GCCAAAAACTATGCCCATCGTCTGTTGATGGATTTAGGCTTTTCAAGAGATGTAATGTCA
  CAATCACCATTTCAAATGTCAGGTGGACAAATGCGTAAAATAGCGATTGTATCGATATTG
  GCAATGAATCCTGATATTATCGTGGTTGATGAACCTACAGCAGGACTTGATCCACAAAGT
  AAACGACAAGTAATGAGATTACTAAAGTCACTACAAACAGATGAAAATAAGGCAATTATC
  CTAATTTCACATGATATGAATGAAGTCGCGCGTTATGCAGATGAAGTCATCGTTATGAAA
  GAAGGTAGTATAGTGTCGCAAACATCACCAAAAGAGCTCTTCAAAGATAAAAAAAAATTG
  GCGGATTGGCATATTGGTTTGCCAGAAATTGTTCAGTTACAATATGACTTTGAACAAAAA
  TATCAAACAAAATTAAAAGATATTGCCTTAACTGAAGAAGCATTTGTAAGCTTGTATAAG
  GAGTGGCAACATGAAAAATAA
  60
  120
  180
  240
  300
  360
  420
  480
  540
  600
  660
  720
  780
  840
  861
  

⊟Protein

⊟General

• locus tag: SAUSA300_2175 [new locus tag: SAUSA300_RS12005 ]
• symbol: CbiO
• description: cobalt transporter ATP-binding subunit
• length: 286
• theoretical pI: 7.25591
• theoretical MW: 32918.6
• GRAVY: -0.461538

⊟Function

• reaction:
  EC 3.6.3.-?  ExPASy
• TIGRFAM:
  Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 367.8)
  and 79 more
  Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 256.1)
  Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 154.4)
  Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 153.5)
  Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 152.4)
  Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 145)
  Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 144.3)
  Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 140.9)
  D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 135.3)
  Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 132.7)
  Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 130)
  Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 129.1)
  Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 129.1)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 123.1)
  ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 122.5)
  Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 122.2)
  Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 120.6)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 120.6)
  Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 119.6)
  Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 119.4)
  ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 118.9)
  thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 118)
  Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 115.6)
  Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 115.6)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 114.1)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 112.4)
  Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 110.4)
  ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 109.4)
  2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 107.1)
  Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 104.6)
  Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 104.6)
  Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 104.3)
  thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 103.2)
  Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 100.9)
  Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 98.9)
  Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 98.9)
  Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 97.7)
  Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 95.9)
  Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 95.9)
  Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 94.9)
  Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 93.4)
  Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 93.4)
  gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 92.8)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 91.4)
  Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 91.4)
  Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 91.4)
  Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 88.9)
  Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 88.9)
  proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 86.8)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 83.9)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 82.6)
  Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 81.3)
  lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 78.6)
  phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 77)
  Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 76.5)
  Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 76.5)
  Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 74.6)
  Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 72.6)
  Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 72.6)
  Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 72.1)
  Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 68.9)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 66.8)
  Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 66.4)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 56.3)
  Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 56.3)
  ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 51.3)
  Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 46.7)
  Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 42.6)
  Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 38.8)
  Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 35.4)
  Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA repair protein RecN (TIGR00634; HMM-score: 20.8)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking putative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 18.7)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 17.9)
  Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 16.1)
  Cellular processes Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 15.5)
  helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 13.3)
  Genetic information processing DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 13.1)
  Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions dTMP kinase (TIGR00041; EC 2.7.4.9; HMM-score: 13)
  Genetic information processing Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 13)
  Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 12.1)
• TheSEED  :
  • ECF transporter, ATPase component of energizing module
  Cofactors, Vitamins, Prosthetic Groups, Pigments Folate and pterines Folate Biosynthesis  ATPase component of general energizing module of ECF transporters
  and 1 more
  Membrane Transport Membrane Transport - no subcategory ECF class transporters  ATPase component of general energizing module of ECF transporters
• PFAM:
  P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 102.9)
  and 32 more
  AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 57.5)
  SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 36.4)
  AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 28.4)
  RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 25.1)
  AAA_15; AAA ATPase domain (PF13175; HMM-score: 25)
  AAA_22; AAA domain (PF13401; HMM-score: 22.1)
  ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 21.9)
  AAA_23; AAA domain (PF13476; HMM-score: 19.9)
  Zeta_toxin; Zeta toxin (PF06414; HMM-score: 19.5)
  AAA_30; AAA domain (PF13604; HMM-score: 18.2)
  DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 17.1)
  AAA_16; AAA ATPase domain (PF13191; HMM-score: 16.6)
  MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 16.2)
  Dynamin_N; Dynamin family (PF00350; HMM-score: 15.5)
  DUF87; Domain of unknown function DUF87 (PF01935; HMM-score: 15.3)
  SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 15.2)
  RNA_helicase; RNA helicase (PF00910; HMM-score: 15)
  T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 14.8)
  NACHT; NACHT domain (PF05729; HMM-score: 14.8)
  G-alpha; G-protein alpha subunit (PF00503; HMM-score: 14.5)
  AAA_18; AAA domain (PF13238; HMM-score: 13.9)
  NB-ARC; NB-ARC domain (PF00931; HMM-score: 13.4)
  AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 13.4)
  AAA_33; AAA domain (PF13671; HMM-score: 13.4)
  AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 13.3)
  AAA_19; AAA domain (PF13245; HMM-score: 13)
  Pox_A32; Poxvirus A32 protein (PF04665; HMM-score: 12.9)
  NTPase_1; NTPase (PF03266; HMM-score: 12.6)
  ABC_ATPase; Predicted ATPase of the ABC class (PF09818; HMM-score: 12.6)
  FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 12.2)
  Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 11.5)
  cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 11.3)

⊟Structure, modifications & cofactors

• domains:
• modifications:
• cofactors:
• effectors:

⊟Localization

• PSORTb: Cytoplasmic Membrane
  • Cytoplasmic Score: 0.01
  • Cytoplasmic Membrane Score: 9.99
  • Cellwall Score: 0
  • Extracellular Score: 0
  • Internal Helices: 0
• LocateP: Intracellular
  • Prediction by SwissProt Classification: Cytoplasmic
  • Pathway Prediction: No pathway
  • Intracellular possibility: 1
  • Signal peptide possibility: -1
  • N-terminally Anchored Score: 1
  • Predicted Cleavage Site: No CleavageSite
• SignalP: no predicted signal peptide
  • SP(Sec/SPI): 0.022611
  • TAT(Tat/SPI): 0.00035
  • LIPO(Sec/SPII): 0.001355
• predicted transmembrane helices (TMHMM): 0

⊟Accession numbers

• GI: 87160333 NCBI
• RefSeq: YP_494810 NCBI
• UniProt: Q2FER8 UniProt

⊟Protein sequence

• MTIRFDNVSYTYQKGTPYQHQAIHDVNTEFEQGKYYAIVGQTGSGKSTLIQNINALLKPTTGTVTVDDITITHKTKDKYIRPVRKRIGMVFQFPESQLFEDTVEREMIFGPKNFKMNLDEAKNYAHRLLMDLGFSRDVMSQSPFQMSGGQMRKIAIVSILAMNPDIIVVDEPTAGLDPQSKRQVMRLLKSLQTDENKAIILISHDMNEVARYADEVIVMKEGSIVSQTSPKELFKDKKKLADWHIGLPEIVQLQYDFEQKYQTKLKDIALTEEAFVSLYKEWQHEK

⊟Experimental data

• experimentally validated: data available for COL, NCTC8325
• protein localization: data available for COL
• quantitative data / protein copy number per cell:
• interaction partners:

⊟Expression & Regulation

⊟Operon

• MicrobesOnline: truA < SAUSA300_2174 < cbiO < cbiO

⊟Regulation

• regulator:

⊟Transcription pattern

• S.aureus Expression Data Browser: data available for NCTC8325

⊟Protein synthesis (provided by Aureolib)

• Aureolib: no data available

⊟Protein stability

• half-life: no data available

⊟Biological Material

⊟Mutants

⊟Expression vector

⊟lacZ fusion

⊟GFP fusion

⊟two-hybrid system

⊟FLAG-tag construct

⊟Antibody

⊟Other Information

You are kindly invited to share additional interesting facts.

⊟Literature

⊟References

⊟Relevant publications