From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS11025 [old locus tag: SAUSA300_2005 ]
  • pan locus tag?: SAUPAN005301000
  • symbol: SAUSA300_RS11025
  • pan gene symbol?: tsaE
  • synonym:
  • product: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS11025 [old locus tag: SAUSA300_2005 ]
  • symbol: SAUSA300_RS11025
  • product: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
  • replicon: chromosome
  • strand: -
  • coordinates: 2163901..2164335
  • length: 435
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGAATCAATTTGCTATATTTTTAGTTGAGCAATTGAAAAGTGGTGATTTGATTTTACTT
    AACGGAGATTTAGGAGCAGGTAAAACAACGTTAACGCAATTTATAGGAAAAGCTCTTGGT
    GTAAGACGTACGATTAATTCCCCGACATTTAACATCATTAAATCATATAGGGGTAAAAAT
    TTAAAATTGCATCATATGGATTGTTATCGCTTAGAAGATTCTGATGAAGATTTAGGATTT
    GATGAATTTTTCGAAGATCAGGCAATTACTGTTATTGAATGGAGTCAATTTATAAAAGAT
    TTACTTCCAGCGACGCATTTATCTATTAACATTTCAACAATATCTGAAAATACAAGACAA
    ATTGAGTTGTTCGCGCAAGGAGAACATTATGAACAAATTAAGGAGGCAATTATCCATGAA
    TTCGCTGCTCATTGA
    60
    120
    180
    240
    300
    360
    420
    435

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS11025 [old locus tag: SAUSA300_2005 ]
  • symbol: SAUSA300_RS11025
  • description: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
  • length: 144
  • theoretical pI: 4.97011
  • theoretical MW: 16441.5
  • GRAVY: -0.189583

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 125.6)
    and 9 more
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 15.4)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 14.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking putative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 12.7)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 12.4)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 12.4)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 12.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 10.7)
  • TheSEED: see SAUSA300_2005
  • PFAM:
    P-loop_NTPase (CL0023) TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 119.5)
    and 12 more
    AAA_18; AAA domain (PF13238; HMM-score: 21.9)
    NACHT; NACHT domain (PF05729; HMM-score: 16.5)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 14.9)
    AAA_23; AAA domain (PF13476; HMM-score: 14.9)
    dNK; Deoxynucleoside kinase (PF01712; HMM-score: 14.8)
    ABC_tran; ABC transporter (PF00005; HMM-score: 13.4)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 13)
    AAA_22; AAA domain (PF13401; HMM-score: 12.7)
    AAA_33; AAA domain (PF13671; HMM-score: 12.7)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 12.5)
    TIM_barrel (CL0036) DUF561; Protein of unknown function (DUF561) (PF04481; HMM-score: 12.2)
    P-loop_NTPase (CL0023) Zeta_toxin; Zeta toxin (PF06414; HMM-score: 12.1)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.010491
    • TAT(Tat/SPI): 0.001918
    • LIPO(Sec/SPII): 0.002381
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MNQFAIFLVEQLKSGDLILLNGDLGAGKTTLTQFIGKALGVRRTINSPTFNIIKSYRGKNLKLHHMDCYRLEDSDEDLGFDEFFEDQAITVIEWSQFIKDLLPATHLSINISTISENTRQIELFAQGEHYEQIKEAIIHEFAAH

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]