From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS11940 [old locus tag: SAUSA300_2166 ]
  • pan locus tag?: SAUPAN005625000
  • symbol: SAUSA300_RS11940
  • pan gene symbol?: budB
  • synonym:
  • product: acetolactate synthase AlsS

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS11940 [old locus tag: SAUSA300_2166 ]
  • symbol: SAUSA300_RS11940
  • product: acetolactate synthase AlsS
  • replicon: chromosome
  • strand: -
  • coordinates: 2344279..2345943
  • length: 1665
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_007793 (2344279..2345943) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    ATGACTGATAAAAAGTACACTGCAGCCGATATGGTTATTGATACTTTGAAAAATAATGGG
    GTAGAATATGTTTTTGGTATTCCGGGTGCAAAGATTGACTATCTATTTAATGCTTTAATT
    GATGATGGTCCTGAACTTATTGTCACTCGTCATGAACAAAACGCCGCAATGATGGCGCAA
    GGTATTGGAAGATTAACAGGCAAACCGGGTGTAGTACTTGTTACAAGTGGTCCTGGTGTA
    AGTAATTTAACTACTGGATTATTAACCGCAACATCTGAAGGGGATCCTGTATTAGCGTTA
    GGTGGCCAAGTGAAACGTAATGATTTATTACGATTAACGCATCAAAGTATTGATAATGCT
    GCGCTATTAAAATATTCATCAAAATATAGTGAAGAAGTACAAGATCCTGAATCATTATCA
    GAAGTTATGACAAATGCAATTCGAATTGCTACTTCAGGAAAAAATGGCGCAAGTTTTATT
    AGTATTCCGCAAGACGTTATTTCTTCACCAGTTGAATCTAAAGCTATATCACTTTGCCAA
    AAACCAAATTTAGGAGTACCGAGTGAACAAGATATTAATGATGTCATTGAAGCGATTAAA
    AATGCATCATTTCCTGTTTTATTAGCTGGTATGAGAAGTTCAAGTGCAGAAGAAACAAAT
    GCCATTCGCAAATTAGTTGAGCGCACGAATTTACCAGTTGTAGAAACATTCCAAGGTGCA
    GGTGTAATTAGTCGTGAATTAGAAAATCATTTCTTCGGTCGTGTGGGCTTATTCCGCAAT
    CAAGTTGGTGATGAATTATTACGTAAAAGTGATTTAGTTGTTACAATCGGTTATGATCCA
    ATTGAATACGAAGCTAGTAACTGGAATAAAGAATTAGAAACACAAATTATCAATATTGAC
    GAAGTTCAAGCTGAAATTACTAATTATATGCAACCGAAAAAAGAGTTGATTGGTAATATT
    GCTAAAACGATTGAAATGATTTCTGAAAAAGTGGATGAGCCATTTATAAATCAACAACAT
    TTAGACGAATTAGAACAATTAAGAACACATATTGATGAAGAAACTGGTATTAAAGCGACG
    CATGAAGAAGGAATTCTACATCCAGTGGAAATTATTGAATCTATGCAAAAGGTATTAACT
    GATGATACTACTGTAACAGTTGATGTTGGAAGTCACTATATTTGGATGGCACGTAATTTC
    AGAAGTTACAATCCAAGACATTTATTATTTAGCAATGGTATGCAAACGCTTGGTGTAGCA
    TTACCGTGGGCAATTTCAGCTGCACTTGTGCGCCCTAATACGCAAGTTGTGTCCGTTGCT
    GGCGATGGTGGCTTTTTATTTTCATCACAAGATTTAGAAACGGCCGTACGTAAAAATTTA
    AATATCATCCAGCTTATTTGGAATGATGGAAAATATAACATGGTTGAATTCCAAGAAGAA
    ATGAAATATAAACGTTCGTCAGGTGTAGACTTCGGTCCTGTAGATTTTGTAAAATATGCA
    GAATCATTTGGCGCGAAAGGTTTACGAGTTACTAATCAAGAAGAATTAGAAGCGGCAATT
    AAAGAGGGCTATGAAACAGATGGTCCAGTATTAATTGATATACCTGTAAATTACAAAGAT
    AATATCAAACTTTCAACAAATATGTTACCTGACGTATTTAACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1665

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS11940 [old locus tag: SAUSA300_2166 ]
  • symbol: SAUSA300_RS11940
  • description: acetolactate synthase AlsS
  • length: 554
  • theoretical pI: 4.51625
  • theoretical MW: 61168.8
  • GRAVY: -0.222383

Function[edit | edit source]

  • reaction:
    EC 2.2.1.6?  ExPASy
    Acetolactate synthase 2 pyruvate = 2-acetolactate + CO2
  • TIGRFAM:
    Metabolism Energy metabolism Fermentation acetolactate synthase, catabolic (TIGR02418; EC 2.2.1.6; HMM-score: 931.6)
    and 15 more
    Metabolism Amino acid biosynthesis Pyruvate family acetolactate synthase, large subunit, biosynthetic type (TIGR00118; EC 2.2.1.6; HMM-score: 346.1)
    Metabolism Energy metabolism Aerobic pyruvate oxidase (TIGR02720; EC 1.2.3.3; HMM-score: 241.1)
    Cellular processes Cellular processes Detoxification oxalyl-CoA decarboxylase (TIGR03254; EC 4.1.1.8; HMM-score: 197.2)
    Metabolism Central intermediary metabolism Other sulfoacetaldehyde acetyltransferase (TIGR03457; EC 2.3.3.15; HMM-score: 187.4)
    glyoxylate carboligase (TIGR01504; EC 4.1.1.47; HMM-score: 169.4)
    Metabolism Energy metabolism Sugars 3,5/4-trihydroxycyclohexa-1,2-dione hydrolase (TIGR04377; EC 3.7.1.-; HMM-score: 161.9)
    indolepyruvate/phenylpyruvate decarboxylase (TIGR03394; EC 4.1.1.43,4.1.1.74; HMM-score: 93.6)
    Metabolism Central intermediary metabolism Other indolepyruvate decarboxylase (TIGR03393; EC 4.1.1.74; HMM-score: 62.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (TIGR00173; EC 2.2.1.9; HMM-score: 57.6)
    phosphonopyruvate decarboxylase (TIGR03297; EC 4.1.1.82; HMM-score: 25.8)
    sulfopyruvate decarboxylase, beta subunit (TIGR03846; EC 4.1.1.79; HMM-score: 25.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other sulfopyruvate decarboxylase, alpha subunit (TIGR03845; EC 4.1.1.79; HMM-score: 21.2)
    Metabolism Energy metabolism Methanogenesis sulfopyruvate decarboxylase, alpha subunit (TIGR03845; EC 4.1.1.79; HMM-score: 21.2)
    2-oxoacid:acceptor oxidoreductase, beta subunit, pyruvate/2-ketoisovalerate family (TIGR02177; HMM-score: 19.3)
    Metabolism Energy metabolism Chemoautotrophy CO dehydrogenase/acetyl-CoA synthase complex, epsilon subunit (TIGR00315; EC 1.2.99.2; HMM-score: 17.2)
  • TheSEED:
  • PFAM:
    THDP-binding (CL0254) TPP_enzyme_N; Thiamine pyrophosphate enzyme, N-terminal TPP binding domain (PF02776; HMM-score: 176)
    TPP_enzyme_C; Thiamine pyrophosphate enzyme, C-terminal TPP binding domain (PF02775; HMM-score: 150)
    and 4 more
    FAD_DHS (CL0085) TPP_enzyme_M; Thiamine pyrophosphate enzyme, central domain (PF00205; HMM-score: 88.8)
    P-loop_NTPase (CL0023) AAA_23; AAA domain (PF13476; HMM-score: 17.6)
    FAD_DHS (CL0085) CO_dh; CO dehydrogenase beta subunit/acetyl-CoA synthase epsilon subunit (PF02552; HMM-score: 14.6)
    Fusion_gly (CL0595) Baculo_F; Baculovirus F protein (PF12259; HMM-score: 10.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004002
    • TAT(Tat/SPI): 0.000185
    • LIPO(Sec/SPII): 0.000309
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446052294 NCBI
  • RefSeq: WP_000130149 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MTDKKYTAADMVIDTLKNNGVEYVFGIPGAKIDYLFNALIDDGPELIVTRHEQNAAMMAQGIGRLTGKPGVVLVTSGPGVSNLTTGLLTATSEGDPVLALGGQVKRNDLLRLTHQSIDNAALLKYSSKYSEEVQDPESLSEVMTNAIRIATSGKNGASFISIPQDVISSPVESKAISLCQKPNLGVPSEQDINDVIEAIKNASFPVLLAGMRSSSAEETNAIRKLVERTNLPVVETFQGAGVISRELENHFFGRVGLFRNQVGDELLRKSDLVVTIGYDPIEYEASNWNKELETQIINIDEVQAEITNYMQPKKELIGNIAKTIEMISEKVDEPFINQQHLDELEQLRTHIDEETGIKATHEEGILHPVEIIESMQKVLTDDTTVTVDVGSHYIWMARNFRSYNPRHLLFSNGMQTLGVALPWAISAALVRPNTQVVSVAGDGGFLFSSQDLETAVRKNLNIIQLIWNDGKYNMVEFQEEMKYKRSSGVDFGPVDFVKYAESFGAKGLRVTNQEELEAAIKEGYETDGPVLIDIPVNYKDNIKLSTNMLPDVFN

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]