Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA_RS12130 [old locus tag: SAS084 ]
- pan locus tag?: SAUPAN005798000
- symbol: SA_RS12130
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA_RS12130 [old locus tag: SAS084 ]
- symbol: SA_RS12130
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 2373757..2373942
- length: 186
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181ATGACAACAGCATTAATTGGTGTAATTGTATTAATCTTACTAATTATTAGCTTTGTGCCA
AACTACCGTGCTATGAAATCAGCAAAAGAACAAGGAAGTAATGCAACAAGAGCTACAATT
ATGGTAGGCATAGATATTATCTTAATTGTACTTATCATCGTGACATTATTATTAAAATAT
ATGTAA60
120
180
186
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA_RS12130 [old locus tag: SAS084 ]
- symbol: SA_RS12130
- description: hypothetical protein
- length: 61
- theoretical pI: 10.3246
- theoretical MW: 6675.29
- GRAVY: 1.36557
⊟Function[edit | edit source]
- TIGRFAM: variant surface antigen, rifin family (TIGR01477; HMM-score: 5.9)
- TheSEED: see SAS084
- PFAM: no clan defined DUF3149; Protein of unknown function (DUF3149) (PF11346; HMM-score: 12.3)Omega_toxin (CL0083) Chi-conotoxin; chi-Conotoxin or t superfamily (PF16981; HMM-score: 10.4)and 3 moreno clan defined Adeno_E3_CR2; Adenovirus E3 region protein CR2 (PF02439; HMM-score: 9.1)FeoB_associated; FeoB-associated Cys-rich membrane protein (PF12669; HMM-score: 9.1)Tbcl_zf (CL0839) DUF2116; Probable treble clef (PF09889; HMM-score: 7.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.32
- Cytoplasmic Membrane Score: 9.55
- Cellwall Score: 0.12
- Extracellular Score: 0.01
- Internal Helices: 2
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.9897
- Cell wall & surface Score: 0
- Extracellular Score: 0.0103
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.054124
- TAT(Tat/SPI): 0.000861
- LIPO(Sec/SPII): 0.059842
- predicted transmembrane helices (TMHMM): 2
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MTTALIGVIVLILLIISFVPNYRAMKSAKEQGSNATRATIMVGIDIILIVLIIVTLLLKYM
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]