From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS13245 [old locus tag: SA2310 ]
  • pan locus tag?: SAUPAN006167000
  • symbol: SA_RS13245
  • pan gene symbol?:
  • synonym:
  • product: glyoxalase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS13245 [old locus tag: SA2310 ]
  • symbol: SA_RS13245
  • product: glyoxalase
  • replicon: chromosome
  • strand: +
  • coordinates: 2595125..2595931
  • length: 807
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002745 (2595125..2595931) NCBI
  • BioCyc: G1G21-2690 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGGCATTTCACGATAAAACAGCAACACAAGTGACAAACATTGAACTGAACGTAAGAGAC
    TTAGACTTAATGACAACATTTTACAAAAACATTTTAGGACTATCCGTTAAAAGTTCTGAC
    GATAACACAACCGTATTATCTGTTGGGACTGGTGGCCATACTCTAACGTTACATTTATTA
    GAAGACGGCCGTCAGACTTCCCCACGTGAAGCAGGACTTTTTCATATAGCATTTTTATTA
    CCAACTACTGAGGATCTAGCTAACTTCTTATATTTCGTGGCACAAAAAAATATGGGCATT
    GGCGCTGGTGATCATTTAGTAAGTGAAGCTTTATATTTCAACGACCCCGAAGGTAATGGT
    ATTGAAGTCTATCGCGATAGACCTTCATCTTCATGGGAATGGCAAAATGGCAAAGTTAAA
    ATGGATACTTTAGAAGTTGATAGCCAAACCTTATTAACACATCGTACTGATGAAGGTTGG
    CAAGGAATGCCAGCAAAAGGCATGATTGGACACTTACATTTAAAAACACATGATTTAGAC
    GCAGCATATCAATGTTACATTGAACAATTAGGATTCCAACATGTGTCTGATTTTCCACGT
    GCGCTATTTATGTCAACGAATCATTATCACCATCATATTGCTGCTAATACTTGGCAATCC
    AATCAAGCAAGACAAAACAATGCACAAAGTTATGGATTAACACATGTTGATATTTATCAA
    CCCGACGCCTCAACACATACATTTACGGCACCAGAAGGGTTTGACATCACAGTTCATTCA
    AATACTGACCTTGTTCCAGAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    807

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS13245 [old locus tag: SA2310 ]
  • symbol: SA_RS13245
  • description: glyoxalase
  • length: 268
  • theoretical pI: 5.58162
  • theoretical MW: 30073.2
  • GRAVY: -0.457463

Function[edit | edit source]

  • TIGRFAM:
    3,4-dihydroxyphenylacetate 2,3-dioxygenase (TIGR02295; EC 1.13.11.15; HMM-score: 45.8)
    Metabolism Energy metabolism Other catechol 2,3 dioxygenase (TIGR03211; EC 1.13.11.2; HMM-score: 43.6)
    and 5 more
    Metabolism Energy metabolism Other 2,3-dihydroxybiphenyl 1,2-dioxygenase (TIGR03213; EC 1.13.11.39; HMM-score: 25.8)
    methylmalonyl-CoA epimerase (TIGR03081; EC 5.1.99.1; HMM-score: 17.2)
    lactoylglutathione lyase family protein (TIGR03645; HMM-score: 16.1)
    Metabolism Energy metabolism Other lactoylglutathione lyase (TIGR00068; EC 4.4.1.5; HMM-score: 12.7)
    Metabolism Central intermediary metabolism Amino sugars lactoylglutathione lyase (TIGR00068; EC 4.4.1.5; HMM-score: 12.7)
  • TheSEED:
  • PFAM:
    Glyoxalase (CL0104) Glyoxalase; Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily (PF00903; HMM-score: 63.5)
    and 1 more
    CppA_N; CppA N-terminal (PF14506; HMM-score: 12.8)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003565
    • TAT(Tat/SPI): 0.000439
    • LIPO(Sec/SPII): 0.000462
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446786712 NCBI
  • RefSeq: WP_000863968 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MAFHDKTATQVTNIELNVRDLDLMTTFYKNILGLSVKSSDDNTTVLSVGTGGHTLTLHLLEDGRQTSPREAGLFHIAFLLPTTEDLANFLYFVAQKNMGIGAGDHLVSEALYFNDPEGNGIEVYRDRPSSSWEWQNGKVKMDTLEVDSQTLLTHRTDEGWQGMPAKGMIGHLHLKTHDLDAAYQCYIEQLGFQHVSDFPRALFMSTNHYHHHIAANTWQSNQARQNNAQSYGLTHVDIYQPDASTHTFTAPEGFDITVHSNTDLVPEK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]