From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS14170 [old locus tag: SA2476 ]
  • pan locus tag?: SAUPAN006440000
  • symbol: SA_RS14170
  • pan gene symbol?:
  • synonym:
  • product: heme ABC transporter ATP-binding protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS14170 [old locus tag: SA2476 ]
  • symbol: SA_RS14170
  • product: heme ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2787227..2788939
  • length: 1713
  • essential: no DEG other strains

Accession numbers[edit | edit source]

  • Location: NC_002745 (2787227..2788939) NCBI
  • BioCyc: SA_RS14170 BioCyc
  • MicrobesOnline: see SA2476

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    ATGACTGAACCAATTATCTCGTTCAAAGACTTTAGTTTTCAATATCATAGTCAAGCAACA
    CCTACATTACAGAATATAAATGTTGATATTTATCCAGGAGAAAAAGTGCTAGTAGTTGGT
    GCTTCAGGTAGTGGTAAATCGACTTTTGCAAATTGCATAAACGGATTAATTCCATTTAAA
    ACTAAAGGTAACATAACCGGGGAACTATATATAAATAATCAAGATGCAACCGTTAGTTGT
    TTACATGATAGATCTAATGTTGTTGGTACAGTTTTACAAGATACAGATGGACAGTTCATA
    GGCTTAACAGCAGCTGAAGATATGGCCTTTTTATTAGAAAATAATTGTGTTGAACAAGAT
    GATATGAAGAAAAATGTAAGTTATTGGGCTGAAAAAGTTGGCATGATAGAACATTTAAAT
    CACCGACCGCAAGATTTATCTGGAGGTCAAAAACAACGCGTTTCATTAGGTGGTATATTA
    ATCCATCGTACGCCTATTTTAATATTGGATGAGCCGCTGGCCAATTTAGATCCTGCGACA
    GGACATGAAACGCTGAGATTGTTAAACAATATTCATGAAGAAACAAAGTCAACGATGATT
    ATTGTCGAACATCGATTAGAAGAATCATTAGATGATACGTTTGATAGAGTTCTTCTTTTT
    AAAGATGGAAAAATCATCGCTAATACAACGCCTAGTGATTTGCTAAAATCATCTAAGCTT
    AAAGAAGCAGGCATACGTGAACCATTATACTGTACAGCGCTTAAATATGCAGAAGTAGAT
    GTCGAATCCATTGATAACTTAGCGAATTTACGTGACGTTTGTATGAGTGAACATGTTAAA
    TTTAAAGTGAAAAAATGGATAGATGAAACATCTGCAAATAATGATAATAAGTACAAATCT
    GAACCGCTATTAGAATTAAATGAGGTATGTGTTCAATATAGTGACTATAGTAATAGTGTA
    CTTAATAATGTTCAATTAAATGTTTATAGAAGAGAAATGCTTAGTATAGTTGGTCACAAT
    GGTGCCGGCAAATCAACACTTGCTAAAGCAATTTGTGGATTTTTAGATATAACAGGTAAT
    ATCCAATTTTGTAATAGGGGATTTAATCAATTGTCAATTAGCGAACGATCTGAATTCGTA
    GGTTATGTGATGCAAAATCCAAATCATATGATTTCTGAAAAAATGATTTACGATGAAGTA
    GCATTAGGGTTAAGAGCACGAGGTATGAAAGAATCAGATATAAAGATACGAGTAGAGAAT
    GTGCTCAAAATATGCGGACTTTATGCATTTCGGAATTGGCCAATTGCAGCTTTAAGCTAT
    GGTCAAAAAAAGAGGGTCACTATAGCATCTGTTTTAGTCTTAAATCCGGAAATAATCATA
    TTGGATGAACCGACTGCTGGTCAAGATTTCTATCATTATAATGAGATAATGTCATTTTTA
    ATTGAGCTAAACAGACAGGGAAAGACGATTATTATGATTACGCATGATATGCATTTATTG
    TCTGAGTATAGTTCAAGAACAGTTGTATTATCAAAAGGACAAGTCGTTGCTGATACCACG
    CCAGTATTGATATTAAATGATAAAAAAATCTGTGAGATTGCATCATTGAGACAAACATCG
    CTATTTGAAATGGCCGAATATATAGGGATTAGCGAGCCACAGAAATTAGTACAATTATTT
    ATTAACCATGATAGGAAGGTGAGACGCCAATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1713


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS14170 [old locus tag: SA2476 ]
  • symbol: SA_RS14170
  • description: heme ABC transporter ATP-binding protein
  • length: 570
  • theoretical pI: 6.01395
  • theoretical MW: 64158.1
  • GRAVY: -0.206667

Function[edit | edit source]

  • reaction:
    EC 3.6.3.-?  ExPASy
  • TIGRFAM:
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 387.6)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 338.4)
    and 88 more
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 248.8)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 246.3)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 228)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 228)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 215.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 212.5)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 208.5)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 207.3)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 202.5)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 202.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 199.5)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 198.7)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 196.5)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 196.3)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 196)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 191.2)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 188.4)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 186.4)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 186.4)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 185.2)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 181.1)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 180.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 179.3)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 177.1)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 177)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 175)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 174.6)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 172.3)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 172)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 172)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 171.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 170.1)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 170.1)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 170.1)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 166.9)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 159.4)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 159.4)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 159)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 158.1)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 156.9)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 156.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 152.7)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 152.5)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 148.6)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 148.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 148.4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 142.8)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 142.8)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 142.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 142.2)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 141.8)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 137.5)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 137.5)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 134.5)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 130.5)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 129.4)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 128.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 126.7)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 115.5)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 114)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 111.1)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 111.1)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 106.9)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 102.7)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 94.7)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 76.4)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 68)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 65.2)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 62.6)
    P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 23)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 16.9)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA replication and repair protein RecF (TIGR00611; HMM-score: 16)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 15.8)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 15.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VII secretion protein EccCb (TIGR03925; HMM-score: 14.5)
    Metabolism Central intermediary metabolism Sulfur metabolism adenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 13.9)
    Cellular processes Cellular processes Conjugation P-type conjugative transfer ATPase TrbB (TIGR02782; HMM-score: 13.6)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 13.2)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DnaA regulatory inactivator Hda (TIGR03420; HMM-score: 13.2)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair phage/plasmid primase, P4 family, C-terminal domain (TIGR01613; HMM-score: 13)
    Genetic information processing Mobile and extrachromosomal element functions Prophage functions phage/plasmid primase, P4 family, C-terminal domain (TIGR01613; HMM-score: 13)
    helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 12.9)
    KaiC domain protein, AF_0351 family (TIGR03880; HMM-score: 12.4)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 12)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 12)
    sugar-phosphate isomerase, RpiB/LacA/LacB family (TIGR00689; EC 5.3.1.-; HMM-score: 12)
    Genetic information processing Transcription RNA processing polynucleotide kinase-phosphatase (TIGR04075; HMM-score: 11.6)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 10.3)
  • TheSEED: see SA2476
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 192.9)
    and 52 more
    no clan defined DUF3744; ATP-binding cassette cobalt transporter (PF12558; HMM-score: 74.4)
    P-loop_NTPase (CL0023) SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 48.5)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 39.4)
    AAA_23; AAA domain (PF13476; HMM-score: 37)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 36.3)
    AAA_22; AAA domain (PF13401; HMM-score: 31.4)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 29.8)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 28.7)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 26.5)
    AAA_33; AAA domain (PF13671; HMM-score: 24)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 22.6)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 21.4)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 20.6)
    nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 20.4)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 20.1)
    nSTAND1; Novel STAND NTPase 1 (PF20703; HMM-score: 20.1)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 19.5)
    NACHT; NACHT domain (PF05729; HMM-score: 19)
    AAA_18; AAA domain (PF13238; HMM-score: 18.7)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 18.2)
    DUF87; Helicase HerA, central domain (PF01935; HMM-score: 18)
    FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 17.9)
    ABC_ATPase; P-loop domain (PF09818; HMM-score: 17.9)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 17.4)
    DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 17.3)
    AAA_25; AAA domain (PF13481; HMM-score: 17.2)
    AAA_24; AAA domain (PF13479; HMM-score: 16.3)
    ATPase; KaiC (PF06745; HMM-score: 15.9)
    SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 15.7)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 15.5)
    AAA_27; AAA domain (PF13514; HMM-score: 15.4)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 15)
    G-alpha; G-protein alpha subunit (PF00503; HMM-score: 14.7)
    NPHP3_N; Nephrocystin 3, N-terminal (PF24883; HMM-score: 14.5)
    Septin; Septin (PF00735; HMM-score: 14.3)
    AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 14.2)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 14.1)
    AAA_14; AAA domain (PF13173; HMM-score: 13.8)
    AAA_13; AAA domain (PF13166; HMM-score: 13.5)
    Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 13.5)
    MeaB; Methylmalonyl Co-A mutase-associated GTPase MeaB (PF03308; HMM-score: 13.4)
    PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 13.1)
    APS_kinase; Adenylylsulphate kinase (PF01583; HMM-score: 13)
    ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 13)
    NTPase_1; NTPase (PF03266; HMM-score: 12.4)
    DUF815; Protein of unknown function (DUF815) (PF05673; HMM-score: 12.4)
    PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 12.2)
    AAA_19; AAA domain (PF13245; HMM-score: 12.1)
    Viral_helicase1; Viral (Superfamily 1) RNA helicase (PF01443; HMM-score: 11.8)
    AAA_28; AAA domain (PF13521; HMM-score: 11.3)
    AIG1; AIG1 family (PF04548; HMM-score: 10.9)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 10)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.17
    • Cytoplasmic Membrane Score: 9.51
    • Cellwall Score: 0.16
    • Extracellular Score: 0.15
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.1243
    • Cytoplasmic Membrane Score: 0.8713
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.0044
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.059546
    • TAT(Tat/SPI): 0.001419
    • LIPO(Sec/SPII): 0.003022
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MTEPIISFKDFSFQYHSQATPTLQNINVDIYPGEKVLVVGASGSGKSTFANCINGLIPFKTKGNITGELYINNQDATVSCLHDRSNVVGTVLQDTDGQFIGLTAAEDMAFLLENNCVEQDDMKKNVSYWAEKVGMIEHLNHRPQDLSGGQKQRVSLGGILIHRTPILILDEPLANLDPATGHETLRLLNNIHEETKSTMIIVEHRLEESLDDTFDRVLLFKDGKIIANTTPSDLLKSSKLKEAGIREPLYCTALKYAEVDVESIDNLANLRDVCMSEHVKFKVKKWIDETSANNDNKYKSEPLLELNEVCVQYSDYSNSVLNNVQLNVYRREMLSIVGHNGAGKSTLAKAICGFLDITGNIQFCNRGFNQLSISERSEFVGYVMQNPNHMISEKMIYDEVALGLRARGMKESDIKIRVENVLKICGLYAFRNWPIAALSYGQKKRVTIASVLVLNPEIIILDEPTAGQDFYHYNEIMSFLIELNRQGKTIIMITHDMHLLSEYSSRTVVLSKGQVVADTTPVLILNDKKICEIASLRQTSLFEMAEYIGISEPQKLVQLFINHDRKVRRQ

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]


Relevant publications[edit | edit source]