From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0098 [new locus tag: NWMN_RS00550 ]
  • pan locus tag?: SAUPAN000977000
  • symbol: capD
  • pan gene symbol?: capD
  • synonym:
  • product: polysaccharide biosynthesis protein CapD

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0098 [new locus tag: NWMN_RS00550 ]
  • symbol: capD
  • product: polysaccharide biosynthesis protein CapD
  • replicon: chromosome
  • strand: +
  • coordinates: 121614..123449
  • length: 1836
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    ATGAGGGGTTTTATGGCACATTTATCTGTGAAATTGCGGCTTTTAATACTAGCATTAATC
    GATTCACTGATAGTGACATTTTCAGTATTCGTAAGTTATTACATTTTAGAACCGTATTTC
    AAAACATATTCTGTCAAATTATTAATATTGGCAGCTATATCACTATTCATATCGCATCAT
    ATTTCAGCATTTATTTTTAATATGTATCATCGAGCGTGGGAATATGCCAGTGTGAGTGAA
    TTGATTTTAATTGTTAAAGCTGTGACGACATCTATCGTTATTACGATGGTGGTCGTGACA
    ATTGTTACAGGCAATAGACCGTTTTTTAGATTGTATTTAATTACTTGGATGATGCACTTG
    ATTTTAATAGGTGGCTCAAGGTTATTTTGGCGTATTTATCGGAAATACCTTGGAGGTAAG
    TCATTTAATAAGAAGCCAACTTTAGTTGTTGGTGCTGGTCAAGCAGGTTCAATGCTGATT
    AGACAAATGTTGAAAAGTGACGAAATGAAACTTGAACCGGTATTAGCAGTCGATGATGAC
    GAACATAAACGCAATATCACAATTACTGAGGGTGTAAAAGTCCAAGGTAAAATTGCGGAT
    ATTCCAGAACTAGTGAGGAAATATAAGATTAAAAAAATCATCATTGCAATTCCAACTATT
    GGTCAAGAGCGTTTGAAAGAAATTAATAATATTTGCCATATGGATGGCGTTGAGTTATTG
    AAAATGCCAAATATAGAAGACGTCATGTCTGGTGAGTTAGAAGTGAACCAACTTAAAAAA
    GTTGAAGTAGAAGATTTACTAGGCAGAGATCCTGTTGAATTAGATATGGATATGATATCA
    AATGAATTGACGAATAAAACTATTTTAGTTACGGGTGCAGGTGGTTCAATAGGATCAGAA
    ATTTGTAGACAAGTTTGTAATTTCTATCCAGAACGTATTATTCTACTTGGCCATGGTGAA
    AACAGTATTTATTTAATCAATCGTGAATTGCGAAATCGCTTCGGAAAAAATGTTGATATC
    GTTCCTATTATAGCGGATGTGCAAAATAGAGCGCGTATGTTTGAAATTATGGAAACGTAT
    AAACCATACGCAGTTTATCATGCAGCAGCACACAAGCACGTGCCGTTAATGGAAGACAAC
    CCTGAAGAAGCAGTACGTAATAATATTTTAGGTACGAAAAATACTGCTGAAGCTGCTAAA
    AATGCAGAGGTAAAGAAATTCGTTATGATTTCTACGGATAAAGCCGTTAATCCGCCTAAT
    GTCATGGGAGCTTCAAAGCGAATTGCAGAAATGATTATTCAAAGTTTAAATGATGAAACG
    CATCGAACAAATTTTGTTGCAGTGAGATTTGGTAATGTACTTGGATCGAGAGGATCTGTG
    ATTCCACTTTTCAAAAGTCAAATTGAAGAAGGTGGGCCAGTTACTGTGACACATCCTGAA
    ATGACACGTTACTTTATGACAATTCCTGAAGCTTCTAGACTAGTTTTGCAGGCAGGGGCA
    TTAGCAGAAGGTGGCGAAGTATTTGTGCTAGATATGGGAGAACCAGTGAAAATTGTAGAT
    TTGGCACGTAATTTAATTAAGCTAAGTGGTAAAAAAGAAGACGACATACGCATTACTTAT
    ACAGGGATTAGACCCGGCGAAAAAATGTTTGAAGAGCTTATGAATAAAGATGAGGTTCAT
    CCTGAACAAGTATTTGAAAAAATTTATCGTGGCAAAGTACAACATATGAAATGTAATGAA
    GTTGAAGCGATTATTCAAGACATCGTCAATGACTTTAGTAAAGAAAAAATTATTAACTAT
    GCCAATGGCAAAAAGGGAGATAATTATGTTCGATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1836

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0098 [new locus tag: NWMN_RS00550 ]
  • symbol: CapD
  • description: polysaccharide biosynthesis protein CapD
  • length: 611
  • theoretical pI: 8.69271
  • theoretical MW: 69131.5
  • GRAVY: -0.00180033

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    UDP-N-acetylglucosamine 4,6-dehydratase (inverting) (TIGR03589; EC 4.2.1.115; HMM-score: 204.3)
    UDP-N-acetylglucosamine 4,6-dehydratase/5-epimerase (TIGR04130; EC 4.2.1.-,5.1.3.-; HMM-score: 164.9)
    exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase (TIGR03025; HMM-score: 98.1)
    undecaprenyl-phosphate glucose phosphotransferase (TIGR03023; EC 2.7.8.-; HMM-score: 87.3)
    MetabolismEnergy metabolismSugarsUDP-glucose 4-epimerase GalE (TIGR01179; EC 5.1.3.2; HMM-score: 63.2)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesdTDP-glucose 4,6-dehydratase (TIGR01181; EC 4.2.1.46; HMM-score: 54.9)
    undecaprenyl-phosphate galactose phosphotransferase WbaP (TIGR03022; EC 2.7.8.6; HMM-score: 52.3)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesdTDP-4-dehydrorhamnose reductase (TIGR01214; EC 1.1.1.133; HMM-score: 45.1)
    NAD dependent epimerase/dehydratase, LLPSF_EDH_00030 family (TIGR04180; HMM-score: 42.3)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesCDP-glucose 4,6-dehydratase (TIGR02622; EC 4.2.1.45; HMM-score: 39.2)
    hopanoid-associated sugar epimerase (TIGR03466; HMM-score: 33.6)
    sugar transferase, PEP-CTERM system associated (TIGR03013; HMM-score: 29.9)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesADP-glyceromanno-heptose 6-epimerase (TIGR02197; EC 5.1.3.20; HMM-score: 24.4)
    rhamnulose-1-phosphate aldolase/alcohol dehydrogenase (TIGR02632; EC 1.1.1.1,4.1.2.19; HMM-score: 15.7)
    thioester reductase domain (TIGR01746; HMM-score: 15.1)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesGDP-mannose 4,6-dehydratase (TIGR01472; EC 4.2.1.47; HMM-score: 14.5)
    2-hydroxycyclohexanecarboxyl-CoA dehydrogenase (TIGR03206; EC 1.1.1.-; HMM-score: 12.7)
  • TheSEED:  
    Capsular polysaccharide synthesis enzyme Cap8D 
  • PFAM:
    NADP_Rossmann (CL0063) Polysacc_synt_2; Polysaccharide biosynthesis protein (PF02719; HMM-score: 423.4)
    Epimerase; NAD dependent epimerase/dehydratase family (PF01370; HMM-score: 87.9)
    CoA_binding_3; CoA-binding domain (PF13727; HMM-score: 65.7)
    GDP_Man_Dehyd; GDP-mannose 4,6 dehydratase (PF16363; HMM-score: 58.9)
    RmlD_sub_bind; RmlD substrate binding domain (PF04321; HMM-score: 49.5)
    3Beta_HSD; 3-beta hydroxysteroid dehydrogenase/isomerase family (PF01073; HMM-score: 42.8)
    NAD_binding_10; NAD(P)H-binding (PF13460; HMM-score: 29.7)
    KR; KR domain (PF08659; HMM-score: 25.2)
    NAD_binding_4; Male sterility protein (PF07993; HMM-score: 21.4)
    adh_short; short chain dehydrogenase (PF00106; HMM-score: 20.2)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 20)
    GFO_IDH_MocA; Oxidoreductase family, NAD-binding Rossmann fold (PF01408; HMM-score: 16)
    CoA_binding; CoA binding domain (PF02629; HMM-score: 15.1)
    DapB_N; Dihydrodipicolinate reductase, N-terminus (PF01113; HMM-score: 14.5)
    Shikimate_DH; Shikimate / quinate 5-dehydrogenase (PF01488; HMM-score: 14.4)
    Sacchrp_dh_NADP; Saccharopine dehydrogenase NADP binding domain (PF03435; HMM-score: 13.4)
    HTH (CL0123) DUF1133; Protein of unknown function (DUF1133) (PF06576; HMM-score: 12.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 4
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: 0
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.226
    • Ymax_pos: 12
    • Cmax: 0.131
    • Cmax_pos: 63
    • Smax: 0.658
    • Smax_pos: 1
    • Smean: 0.485
    • D: 0.327
  • predicted transmembrane helices (TMHMM): 4

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MRGFMAHLSVKLRLLILALIDSLIVTFSVFVSYYILEPYFKTYSVKLLILAAISLFISHHISAFIFNMYHRAWEYASVSELILIVKAVTTSIVITMVVVTIVTGNRPFFRLYLITWMMHLILIGGSRLFWRIYRKYLGGKSFNKKPTLVVGAGQAGSMLIRQMLKSDEMKLEPVLAVDDDEHKRNITITEGVKVQGKIADIPELVRKYKIKKIIIAIPTIGQERLKEINNICHMDGVELLKMPNIEDVMSGELEVNQLKKVEVEDLLGRDPVELDMDMISNELTNKTILVTGAGGSIGSEICRQVCNFYPERIILLGHGENSIYLINRELRNRFGKNVDIVPIIADVQNRARMFEIMETYKPYAVYHAAAHKHVPLMEDNPEEAVRNNILGTKNTAEAAKNAEVKKFVMISTDKAVNPPNVMGASKRIAEMIIQSLNDETHRTNFVAVRFGNVLGSRGSVIPLFKSQIEEGGPVTVTHPEMTRYFMTIPEASRLVLQAGALAEGGEVFVLDMGEPVKIVDLARNLIKLSGKKEDDIRITYTGIRPGEKMFEELMNKDEVHPEQVFEKIYRGKVQHMKCNEVEAIIQDIVNDFSKEKIINYANGKKGDNYVR

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor: SigB [1] [2] other strains
    SigB (sigma factor) controls a large regulon involved in stress/starvation response and adaptation
  • regulator: CodY
    CodY (TF) important in Amino acid metabolismRegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Bettina Schulthess, Dominik A Bloes, Patrice François, Myriam Girard, Jacques Schrenzel, Markus Bischoff, Brigitte Berger-Bächi
    The σB-dependent yabJ-spoVG operon is involved in the regulation of extracellular nuclease, lipase, and protease expression in Staphylococcus aureus.
    J. Bacteriol.: 2011, 193(18);4954-62
    [PubMed:21725011] [WorldCat.org] [DOI] (I p)
  2. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J. Bacteriol.: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)

Relevant publications[edit source | edit]