From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0462 [new locus tag: NWMN_RS02640 ]
  • pan locus tag?: SAUPAN002239000
  • symbol: glmU
  • pan gene symbol?: glmU
  • synonym:
  • product: bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0462 [new locus tag: NWMN_RS02640 ]
  • symbol: glmU
  • product: bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase
  • replicon: chromosome
  • strand: +
  • coordinates: 523514..524872
  • length: 1359
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGTTCATGCGAAGACACGCGATAATTTTGGCAGCAGGTAAAGGCACAAGAATGAAATCT
    AAAAAGTATAAAGTGCTACACGAGGTTGCTGGGAAACCTATGGTCGAACATGTATTGGAA
    AGTGTGAAAGGCTCTGGTGTCGATCAAGTTGTAACCATCGTAGGACATGGTGCTGAAAGT
    GTAAAAGGACATTTAGGCGAGCGTTCTTTATACAGTTTTCAAGAGGAACAACTCGGTACT
    GCGCATGCAGTGCAAATGGCGAAATCACACTTAGAAGACAAGGAAGGTACGACAATCGTT
    GTATGTGGTGACACACCGCTCATCACAAAGGAAACATTAGAAACATTGATTGCGCATCAC
    GAGGATGCTAATGCTCAAGCAACTGTATTATCTGCATCGATTCAACAACCATATGGATAC
    GGAAGAATCGTTCGAAATGCGTCAGGTCGTTTAGAACGCATAGTTGAAGAGAAAGATGCA
    ACGCAAGCTGAAAAGGATATTAATGAAATTAGTTCAGGTATTTTTGCGTTTAATAATAAA
    ACGTTGTTTGAAAAATTAACACAAGTGAAAAATGATAATGCGCAAGGTGAATATTACCTC
    CCTGATGTATTGTCGTTAATTTTAAATGATGGCGGCATCGTAGAAGTCTATCGTACCAAT
    GATGTTGAAGAAATCATGGGTGTAAATGATCGTGTAATGCTTAGTCAGGCTGAGAAGGCG
    ATGCAACGTCGTACGAATCATTATCACATGCTAAATGGTGTGACAATCATCGATCCTGAC
    AGCACTTATATTGGTCCAGACGTTACAATTGGTAGTGATACAGTCATTGAACCAGGCGTA
    CGAATTAATGGTCGTACAGAAATTGGCGAAGATGTTGTTATTGGTCAGTACTCTGAAATT
    AACAATAGTACGATTGAAAATGGTGCATGTATTCAACAGTCTGTTGTTAATGATGCTAGC
    GTAGGAGCGAATACTAAGGTCGGACCGTTTGCGCAATTGAGACCAGGCGCGCAATTAGGT
    GCAGATGTTAAGGTTGGAAATTTTGTAGAAATTAAAAAAGCAGATCTTAAAGATGGTGCC
    AAGGTTTCACATTTAAGTTATATTGGCGATGCTGTAATTGGCGAACGTACTAATATTGGT
    TGCGGAACGATTACAGTTAACTATGATGGTGAAAATAAATTTAAAACTATCGTCGGCAAA
    GATTCATTTGTAGGTTGCAATGTTAATTTAGTAGCACCTGTAACAATTGGTGATGATGTA
    TTGGTGGCAGCTGGTTCCACAATCACAGATGACGTACCAAATGACAGTTTAGCTGTGGCA
    AGAGCAAGACAAACAACAAAAGAAGGATATAGGAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1359

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0462 [new locus tag: NWMN_RS02640 ]
  • symbol: GlmU
  • description: bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase
  • length: 452
  • theoretical pI: 5.47401
  • theoretical MW: 48810.7
  • GRAVY: -0.254204

Function[edit source | edit]

  • reaction:
    Acetyl-CoA + alpha-D-glucosamine 1-phosphate = CoA + N-acetyl-alpha-D-glucosamine 1-phosphate?
    UTP + N-acetyl-alpha-D-glucosamine 1-phosphate = diphosphate + UDP-N-acetyl-alpha-D-glucosamine?
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesUDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase (TIGR01173; EC 2.3.1.157,2.7.7.23; HMM-score: 590.2)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanUDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase (TIGR01173; EC 2.3.1.157,2.7.7.23; HMM-score: 590.2)
    MetabolismCentral intermediary metabolismAmino sugarsUDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase (TIGR01173; EC 2.3.1.157,2.7.7.23; HMM-score: 590.2)
    UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase (TIGR03992; EC 2.3.1.157,2.7.7.23; HMM-score: 206.4)
    glucose-1-phosphate thymidylyltransferase (TIGR01208; EC 2.7.7.24; HMM-score: 94.2)
    sugar O-acyltransferase, sialic acid O-acetyltransferase NeuD family (TIGR03570; HMM-score: 62.9)
    molybdenum cofactor cytidylyltransferase (TIGR03310; EC 2.7.7.76; HMM-score: 57.5)
    MetabolismEnergy metabolismBiosynthesis and degradation of polysaccharidesglucose-1-phosphate adenylyltransferase (TIGR02091; EC 2.7.7.27; HMM-score: 46.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOther2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (TIGR00453; EC 2.7.7.60; HMM-score: 42.7)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesacyl-[acyl-carrier-protein]-UDP-N-acetylglucosamine O-acyltransferase (TIGR01852; EC 2.3.1.129; HMM-score: 41.9)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesUTP--glucose-1-phosphate uridylyltransferase (TIGR01099; EC 2.7.7.9; HMM-score: 39.5)
    Hypothetical proteinsConservedTIGR00454 family protein (TIGR00454; HMM-score: 38.6)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesUDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase LpxD (TIGR01853; EC 2.3.1.191; HMM-score: 38.2)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesglucose-1-phosphate thymidylyltransferase (TIGR01207; EC 2.7.7.24; HMM-score: 37.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMolybdopterinmolybdenum cofactor guanylyltransferase (TIGR02665; EC 2.7.7.77; HMM-score: 36.6)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharides3-deoxy-D-manno-octulosonate cytidylyltransferase (TIGR00466; EC 2.7.7.38; HMM-score: 35.8)
    colanic acid biosynthesis acetyltransferase WcaB (TIGR04016; EC 2.3.1.-; HMM-score: 27.2)
    phosphonate metabolim protein, transferase hexapeptide repeat family (TIGR03308; HMM-score: 26.6)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanUDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase (TIGR03991; EC 2.3.1.157,2.7.7.23; HMM-score: 26.3)
    MetabolismCentral intermediary metabolismAmino sugarsUDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase (TIGR03991; EC 2.3.1.157,2.7.7.23; HMM-score: 26.3)
    2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase (TIGR03532; EC 2.3.1.89; HMM-score: 26.1)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesglucose-1-phosphate cytidylyltransferase (TIGR02623; EC 2.7.7.33; HMM-score: 25)
    non-ribosomal peptide synthetase terminal domain of unknown function (TIGR02353; HMM-score: 20.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOther2-phospho-L-lactate guanylyltransferase (TIGR03552; EC 2.7.7.68; HMM-score: 19.7)
    MetabolismAmino acid biosynthesisSerine familyserine O-acetyltransferase (TIGR01172; EC 2.3.1.30; HMM-score: 19.6)
    xanthine dehydrogenase accessory protein pucB (TIGR03202; HMM-score: 18.6)
    MetabolismEnergy metabolismOtherphenylacetic acid degradation protein PaaY (TIGR02287; HMM-score: 17.3)
    colanic acid biosynthesis acetyltransferase WcaF (TIGR04008; EC 2.3.1.-; HMM-score: 16.5)
  • TheSEED:  
    Peptidoglycan Biosynthesis N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157) 
    Sialic Acid Metabolism N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157) 
    UDP-N-acetylmuramate from Fructose-6-phosphate Biosynthesis N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157) 
  • PFAM:
    HEXAPEP (CL0536) Hexapep; Bacterial transferase hexapeptide (six repeats) (PF00132; HMM-score: 99.7)
    GT-A (CL0110) NTP_transferase; Nucleotidyl transferase (PF00483; HMM-score: 84.8)
    NTP_transf_3; MobA-like NTP transferase domain (PF12804; HMM-score: 80.7)
    HEXAPEP (CL0536) Hexapep_2; Hexapeptide repeat of succinyl-transferase (PF14602; HMM-score: 37.9)
    GT-A (CL0110) IspD; 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (PF01128; HMM-score: 36.7)
    CTP_transf_3; Cytidylyltransferase (PF02348; HMM-score: 32.9)
    CofC; Guanylyl transferase CofC like (PF01983; HMM-score: 17.1)
    DUF2064; Uncharacterized protein conserved in bacteria (DUF2064) (PF09837; HMM-score: 11.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:
    NWMN_2534(arcA)arginine deiminase  [1] (data from MRSA252)
    NWMN_1587(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    NWMN_0961(pdhC)branched-chain alpha-keto acid dehydrogenase subunit E2  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_0960(phdB)pyruvate dehydrogenase E1 component, beta subunit  [1] (data from MRSA252)
    NWMN_2140(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    NWMN_0499(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    NWMN_0502(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    NWMN_1549(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_2119(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_1382DNA-binding protein HU  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.201
    • Ymax_pos: 14
    • Cmax: 0.109
    • Cmax_pos: 22
    • Smax: 0.481
    • Smax_pos: 2
    • Smean: 0.407
    • D: 0.281
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MFMRRHAIILAAGKGTRMKSKKYKVLHEVAGKPMVEHVLESVKGSGVDQVVTIVGHGAESVKGHLGERSLYSFQEEQLGTAHAVQMAKSHLEDKEGTTIVVCGDTPLITKETLETLIAHHEDANAQATVLSASIQQPYGYGRIVRNASGRLERIVEEKDATQAEKDINEISSGIFAFNNKTLFEKLTQVKNDNAQGEYYLPDVLSLILNDGGIVEVYRTNDVEEIMGVNDRVMLSQAEKAMQRRTNHYHMLNGVTIIDPDSTYIGPDVTIGSDTVIEPGVRINGRTEIGEDVVIGQYSEINNSTIENGACIQQSVVNDASVGANTKVGPFAQLRPGAQLGADVKVGNFVEIKKADLKDGAKVSHLSYIGDAVIGERTNIGCGTITVNYDGENKFKTIVGKDSFVGCNVNLVAPVTIGDDVLVAAGSTITDDVPNDSLAVARARQTTKEGYRK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]