From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2140 [new locus tag: NWMN_RS12365 ]
  • pan locus tag?: SAUPAN005690000
  • symbol: rplE
  • pan gene symbol?: rplE
  • synonym:
  • product: 50S ribosomal protein L5

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_2140 [new locus tag: NWMN_RS12365 ]
  • symbol: rplE
  • product: 50S ribosomal protein L5
  • replicon: chromosome
  • strand: -
  • coordinates: 2369432..2369971
  • length: 540
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    TTGAACCGTTTAAAAGAAAAGTTTAACACTGAAGTTACTGAAAACTTAATGAAAAAATTC
    AATTATAGTTCAGTAATGGAAGTACCAAAAATAGATAAAATCGTTGTGAACATGGGTGTA
    GGTGACGCAGTACAAAATTCTAAAGTATTAGACAATGCTGTTGAAGAATTAGAATTGATC
    ACTGGTCAAAAACCATTAGTAACTAAAGCTAAAAAATCAATCGCGACTTTCCGTTTACGT
    GAAGGTATGCCAATCGGTGCGAAAGTAACACTTCGCGGTGAAAGAATGTATGAATTCTTA
    GACAAATTAATTTCAGTATCATTACCACGTGTACGTGACTTCCAAGGTGTTTCTAAAAAA
    GCATTTGACGGACGCGGTAACTACACTTTAGGTGTTAAAGAACAATTAATTTTCCCAGAA
    ATCGACTATGATAAAGTAAGTAAAGTTAGAGGAATGGATATTGTTATCGTAACGACTGCT
    AACACTGATGAAGAAGCTCGTGAATTGTTAGCTAACTTCGGTATGCCATTCCGTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540

Protein[edit source | edit]

Protein Data Bank: 5LI0
Protein Data Bank: 4WCE
Protein Data Bank: 4WFB
Protein Data Bank: 4WF9
Protein Data Bank: 4WFA
Protein Data Bank: 5HL7

General[edit source | edit]

  • locus tag: NWMN_2140 [new locus tag: NWMN_RS12365 ]
  • symbol: RplE
  • description: 50S ribosomal protein L5
  • length: 179
  • theoretical pI: 9.95029
  • theoretical MW: 20266.5
  • GRAVY: -0.305587

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismEnergy metabolismAmino acids and aminesurocanate hydratase (TIGR01228; EC 4.2.1.49; HMM-score: 10.8)
  • TheSEED:  
    Protein MetabolismProtein biosynthesisRibosome LSU bacterial LSU ribosomal protein L5p (L11e) 
  • PFAM:
    no clan definedRibosomal_L5_C; ribosomal L5P family C-terminus (PF00673; HMM-score: 142.8)
    S24e_L23_L15e (CL0652) Ribosomal_L5; Ribosomal protein L5 (PF00281; HMM-score: 100.3)
    no clan definedUrocanase_N; Urocanase N-terminal domain (PF17391; HMM-score: 14.7)
    DUF2660; Protein of unknown function (DUF2660) (PF10859; HMM-score: 13.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_2534(arcA)arginine deiminase  [1] (data from MRSA252)
    NWMN_1114(carB)carbamoyl phosphate synthase large subunit  [1] (data from MRSA252)
    NWMN_1587(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    NWMN_1483(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_0745(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_0741(gapA)glyceraldehyde 3-phosphate dehydrogenase 1  [1] (data from MRSA252)
    NWMN_1837(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    NWMN_1348(ilvA)threonine dehydratase  [1] (data from MRSA252)
    NWMN_0176(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    NWMN_1680(metK)S-adenosylmethionine synthetase  [1] (data from MRSA252)
    NWMN_0700(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [1] (data from MRSA252)
    NWMN_2040(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_2151(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_1385(rpsA)30S ribosomal protein S1  [1] (data from MRSA252)
    NWMN_2146(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_1613(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    NWMN_2153(rpsJ)30S ribosomal protein S10  [1] (data from MRSA252)
    NWMN_2127(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_0507(rpsL)30S ribosomal protein S12  [1] (data from MRSA252)
    NWMN_2128(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    NWMN_1973(rsbU)sigma factor sigB regulation protein  [1] (data from MRSA252)
    NWMN_0620hypothetical protein  [1] (data from MRSA252)
    NWMN_0641hypothetical protein  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_0881enoyl-(acyl carrier protein) reductase  [1] (data from MRSA252)
    NWMN_0974GTP-binding protein TypA  [1] (data from MRSA252)
    NWMN_2026aldehyde dehydrogenase family protein  [1] (data from MRSA252)
    NWMN_2067ATP-binding Mrp/Nbp35 family protein  [1] (data from MRSA252)
    NWMN_2504malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.153
    • Ymax_pos: 11
    • Cmax: 0.11
    • Cmax_pos: 54
    • Smax: 0.277
    • Smax_pos: 3
    • Smean: 0.234
    • D: 0.185
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNRLKEKFNTEVTENLMKKFNYSSVMEVPKIDKIVVNMGVGDAVQNSKVLDNAVEELELITGQKPLVTKAKKSIATFRLREGMPIGAKVTLRGERMYEFLDKLISVSLPRVRDFQGVSKKAFDGRGNYTLGVKEQLIFPEIDYDKVSKVRGMDIVIVTTANTDEEARELLANFGMPFRK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]