From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2523 [new locus tag: NWMN_RS14500 ]
  • pan locus tag?: SAUPAN006337000
  • symbol: nsaS
  • pan gene symbol?: nsaS
  • synonym:
  • product: susceptibility-associated sensor histidine kinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_2523 [new locus tag: NWMN_RS14500 ]
  • symbol: nsaS
  • product: susceptibility-associated sensor histidine kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 2775182..2776069
  • length: 888
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGACCTTTCTTAAAAGTATTACTCAGGAAATAGCAATAGTCATAGTTATTTTTGCTTTG
    TTTGGCTTAATGTTTTACCTGTATCATTTGCCATTAGAAGCATATTTACTAGCACTTGGC
    GTTATTTTATTATTATTACTCATATTCATAGGTATTAAATATTTAAGTTTTGTAAAAACT
    ATAAGCCAACAACAACAAATTGAAAACTTAGAAAATGCGTTGTATCAGCTTAAAAATGAA
    CAAATTGAATATAAAAATGATGTAGAGAGCTACTTTTTAACATGGGTACATCAAATGAAA
    ACACCCATTACTGCAGCACAACTGTTACTTGAAAGAGATGAGCCTAATGTTGTTAATCGT
    GTTCGTCAAGAGGTTATTCAAATTGATAACTATACAAGTTTAGCACTTAGTTATTTAAAG
    TTATTAAATGAAACTTCTGATATTTCTGTCACTAAAATTTCGATTAATAATATCATTCGC
    CCAATTATTATGAAATATTCAATACAGTTTATTGATCAAAAAACAAAAATCCATTATGAA
    CCTTGTCATCACGAAGTATTAACTGACGTTAGATGGACCTCTTTAATGATAGAACAATTA
    ATAAATAATGCACTTAAGTATGCGAGAGGTAAAGATATATGGATTGAATTTGATGAGCAA
    TCCAATCAATTACACGTAAAAGATAATGGTATCGGTATTAGTGAAGCGGACTTGCCTAAA
    ATATTTGATAAGGGCTATTCAGGTTATAATGGCCAGCGCCAAAGTAACTCAAGTGGGATT
    GGTTTATTTATCGTAAAACAAATTTCAACACACACAAACCATCCTGTTTCAGTCGTATCT
    AAACAAAATGAGGGTACAACATTTACGATTCAATTTCCAGATGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    888

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_2523 [new locus tag: NWMN_RS14500 ]
  • symbol: NsaS
  • description: susceptibility-associated sensor histidine kinase
  • length: 295
  • theoretical pI: 6.09533
  • theoretical MW: 34019
  • GRAVY: -0.0125424

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionSignal transductionTwo-component systemsphosphate regulon sensor kinase PhoR (TIGR02966; EC 2.7.3.-; HMM-score: 62.9)
    heavy metal sensor kinase (TIGR01386; EC 2.7.13.3; HMM-score: 49.3)
    Signal transductionSignal transductionTwo-component systemsTMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 43.7)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingputative PEP-CTERM system histidine kinase (TIGR02916; EC 2.7.13.3; HMM-score: 31.3)
    Signal transductionSignal transductionTwo-component systemsputative PEP-CTERM system histidine kinase (TIGR02916; EC 2.7.13.3; HMM-score: 31.3)
    MetabolismCentral intermediary metabolismNitrogen fixationnitrogen fixation negative regulator NifL (TIGR02938; HMM-score: 30.3)
    Signal transductionRegulatory functionsProtein interactionsnitrogen fixation negative regulator NifL (TIGR02938; HMM-score: 30.3)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA mismatch repair protein MutL (TIGR00585; HMM-score: 20.1)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA topoisomerase VI, B subunit (TIGR01052; EC 5.99.1.3; HMM-score: 17.5)
  • TheSEED:  
    Putative two-component sensor histidine kinase 
  • PFAM:
    His_Kinase_A (CL0025) HATPase_c; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (PF02518; HMM-score: 73.1)
    HATPase_c_3; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (PF13589; HMM-score: 26.9)
    HATPase_c_2; Histidine kinase-like ATPase domain (PF13581; HMM-score: 14.7)
    no clan definedDUF1043; Protein of unknown function (DUF1043) (PF06295; HMM-score: 14.6)
    Phage_holin_3_6; Putative Actinobacterial Holin-X, holin superfamily III (PF07332; HMM-score: 14.5)
    FtsL (CL0225) DivIC; Septum formation initiator (PF04977; HMM-score: 13.8)
    C_Lectin (CL0056) Ly49; Ly49-like protein, N-terminal region (PF08391; HMM-score: 13.6)
    His_Kinase_A (CL0025) HisKA; His Kinase A (phospho-acceptor) domain (PF00512; HMM-score: 12.5)
    no clan definedDUF4131; Domain of unknown function (DUF4131) (PF13567; HMM-score: 11.8)
    IncA; IncA protein (PF04156; HMM-score: 6.9)
    DUF3290; Protein of unknown function (DUF3290) (PF11694; HMM-score: 6.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 2
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.124
    • Ymax_pos: 65
    • Cmax: 0.125
    • Cmax_pos: 65
    • Smax: 0.189
    • Smax_pos: 60
    • Smean: 0.06
    • D: 0.099
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTFLKSITQEIAIVIVIFALFGLMFYLYHLPLEAYLLALGVILLLLLIFIGIKYLSFVKTISQQQQIENLENALYQLKNEQIEYKNDVESYFLTWVHQMKTPITAAQLLLERDEPNVVNRVRQEVIQIDNYTSLALSYLKLLNETSDISVTKISINNIIRPIIMKYSIQFIDQKTKIHYEPCHHEVLTDVRWTSLMIEQLINNALKYARGKDIWIEFDEQSNQLHVKDNGIGISEADLPKIFDKGYSGYNGQRQSNSSGIGLFIVKQISTHTNHPVSVVSKQNEGTTFTIQFPDE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]