From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS04205 [old locus tag: NWMN_0743 ]
  • pan locus tag?: SAUPAN002708000
  • symbol: NWMN_RS04205
  • pan gene symbol?: tpiA
  • synonym:
  • product: triose-phosphate isomerase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS04205 [old locus tag: NWMN_0743 ]
  • symbol: NWMN_RS04205
  • product: triose-phosphate isomerase
  • replicon: chromosome
  • strand: +
  • coordinates: 836417..837178
  • length: 762
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (836417..837178) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAGAACACCAATTATAGCTGGTAACTGGAAAATGAACAAAACAGTACAAGAAGCAAAA
    GACTTCGTCAATGCATTACCAACATTACCAGATTCAAAAGAAGTAGAATCAGTAATTTGT
    GCACCAGCAATTCAATTAGATGCATTAACTACTGCAGTTAAAGAAGGAAAAGCACAAGGT
    TTAGAAATCGGTGCTCAAAATACGTATTTCGAAGATAATGGTGCGTTCACAGGTGAAACG
    TCTCCAGTTGCATTAGCAGATTTAGGCGTTAAATACGTTGTTATCGGTCATTCTGAACGT
    CGTGAATTATTCCACGAAACAGATGAAGAAATTAACAAAAAAGCGCACGCTATTTTCAAA
    CATGGAATGACTCCAATTATATGTGTTGGTGAAACAGACGAAGAGCGTGAAAGTGGTAAA
    GCTAACGATGTTGTAGGTGAGCAAGTTAAGAAAGCTGTTGCAGGTTTATCTGAAGATCAA
    CTTAAATCAGTTGTAATTGCTTATGAACCAATCTGGGCAATCGGAACTGGTAAATCATCA
    ACATCTGAAGATGCAAATGAAATGTGTGCATTTGTACGTCAAACTATTGCTGACTTATCA
    AGCAAAGAAGTATCAGAAGCAACTCGTATTCAATATGGTGGTAGTGTTAAACCTAACAAC
    ATTAAAGAATACATGGCACAAACTGATATTGATGGGGCATTAGTAGGTGGCGCATCACTT
    AAAGTTGAAGATTTCGTACAATTGTTAGAAGGTGCAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    762

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS04205 [old locus tag: NWMN_0743 ]
  • symbol: NWMN_RS04205
  • description: triose-phosphate isomerase
  • length: 253
  • theoretical pI: 4.5163
  • theoretical MW: 27261.5
  • GRAVY: -0.274308

Function[edit source | edit]

  • reaction:
    EC 5.3.1.1?  ExPASy
    Triose-phosphate isomeraseD-glyceraldehyde 3-phosphate = glycerone phosphate
  • TIGRFAM:
    MetabolismEnergy metabolismGlycolysis/gluconeogenesistriose-phosphate isomerase (TIGR00419; EC 5.3.1.1; HMM-score: 197.4)
  • TheSEED:
  • PFAM:
    TIM_barrel (CL0036) TIM; Triosephosphate isomerase (PF00121; HMM-score: 317.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_RS02960elongation factor G  [1] (data from MRSA252)
    NWMN_RS02965elongation factor Tu  [1] (data from MRSA252)
    NWMN_RS05380pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    NWMN_RS05385pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    NWMN_RS05390dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    NWMN_RS06210cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_RS0649050S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_RS07455dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    NWMN_RS07785DNA-binding protein HU  [1] (data from MRSA252)
    NWMN_RS08350molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_RS0868550S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_RS08930pyruvate kinase  [1] (data from MRSA252)
    NWMN_RS08970universal stress protein  [1] (data from MRSA252)
    NWMN_RS08995universal stress protein UspA  [1] (data from MRSA252)
    NWMN_RS1230030S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_RS1233050S ribosomal protein L15  [1] (data from MRSA252)
    NWMN_RS1234030S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_RS1240050S ribosomal protein L22  [1] (data from MRSA252)
    NWMN_RS1241050S ribosomal protein L2  [1] (data from MRSA252)
    NWMN_RS1241550S ribosomal protein L23  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.195
    • Ymax_pos: 20
    • Cmax: 0.216
    • Cmax_pos: 20
    • Smax: 0.261
    • Smax_pos: 1
    • Smean: 0.166
    • D: 0.184
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447182833 NCBI
  • RefSeq: WP_001260089 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MRTPIIAGNWKMNKTVQEAKDFVNALPTLPDSKEVESVICAPAIQLDALTTAVKEGKAQGLEIGAQNTYFEDNGAFTGETSPVALADLGVKYVVIGHSERRELFHETDEEINKKAHAIFKHGMTPIICVGETDEERESGKANDVVGEQVKKAVAGLSEDQLKSVVIAYEPIWAIGTGKSSTSEDANEMCAFVRQTIADLSSKEVSEATRIQYGGSVKPNNIKEYMAQTDIDGALVGGASLKVEDFVQLLEGAK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS04205 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19

Relevant publications[edit source | edit]