From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS04740 [old locus tag: NWMN_0841 ]
  • pan locus tag?: SAUPAN003107000
  • symbol: NWMN_RS04740
  • pan gene symbol?: cdr
  • synonym:
  • product: CoA-disulfide reductase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS04740 [old locus tag: NWMN_0841 ]
  • symbol: NWMN_RS04740
  • product: CoA-disulfide reductase
  • replicon: chromosome
  • strand: -
  • coordinates: 934242..935558
  • length: 1317
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (934242..935558) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGCCCAAAATAGTCGTAGTCGGAGCAGTCGCTGGCGGTGCAACATGTGCCAGCCAAATT
    CGACGTTTAGATAAAGAAAGTGACATTATTATTTTTGAAAAAGATCGTGATATGAGCTTT
    GCTAATTGTGCATTGCCTTATGTCATTGGCGAAGTTGTTGAAGATAGAAGATATGCTTTA
    GCGTATACACCTGAAAAATTTTATGATAGAAAGCAAATTACAGTAAAAACTTATCATGAA
    GTTATTGCAATCAATGATGAAAGACAAACTGTATCTGTATTAAATAGAAAGACAAACGAA
    CAATTTGAAGAATCTTACGATAAACTCATTTTAAGCCCTGGTGCAAGTGCAAATAGCCTT
    GGCTTTGAAAGTGATATTACATTTACACTTAGAAATTTAGAAGACACTGATGCTATCGAT
    CAATTCATCAAAGCAAATCAAGTTGATAAAGTATTGGTTGTAGGTGCAGGTTATGTTTCA
    TTAGAAGTTCTTGAAAATCTTTATGAACGTGGTTTACACCCTACTTTAATTCATCGATCT
    GATAAGATAAATAAATTAATGGATGCCGACATGAATCAACCTATACTTGATGAATTAGAT
    AAGCGGGAGATTCCATACCGTTTAAATGAGGAAATTAATGCTATCAATGGAAATGAAATT
    ACATTTAAATCAGGAAAAGTTGAACATTACGATATGATTATTGAAGGTGTCGGTACTCAC
    CCCAATTCAAAATTTATCGAAAGTTCAAATATCAAACTTGATCGAAAAGGTTTCATACCG
    GTAAACGATAAATTTGAAACAAATGTTCCAAACATTTATGCAATAGGCGATATTGCAACA
    TCACATTATCGACATGTCGATCTACCGGCTAGTGTTCCTTTAGCTTGGGGCGCTCACCGT
    GCAGCAAGTATTGTTGCCGAACAAATTGCTGGAAATGACACTATTGAATTCAAAGGCTTC
    TTAGGCAACAATATTGTGAAGTTCTTTGATTATACATTTGCGAGTGTCGGCGTTAAACCA
    AACGAACTAAAGCAATTTGACTATAAAATGGTAGAAGTCACTCAAGGTGCACACGCGAAT
    TATTACCCAGGAAATTCCCCTTTACACTTAAGAGTATATTATGACACTTCAAACCGTCAG
    ATTTTAAGAGCAGCTGCAGTAGGAAAAGAAGGTGCAGATAAACGTATTGATGTACTATCG
    ATGGCAATGATGAACCAGCTAACTGTAGATGAGTTAACTGAGTTTGAAGTGGCTTATGCA
    CCACCATATAGCCACCCTAAAGATTTAATCAATATGATTGGTTACAAAGCTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1317

Protein[edit source | edit]

Protein Data Bank: 1YQZ
Protein Data Bank: 4EM3
Protein Data Bank: 4EM4
Protein Data Bank: 4EMW
Protein Data Bank: 4EQR
Protein Data Bank: 4EQS
Protein Data Bank: 4EQW
Protein Data Bank: 4EQX

General[edit source | edit]

  • locus tag: NWMN_RS04740 [old locus tag: NWMN_0841 ]
  • symbol: NWMN_RS04740
  • description: CoA-disulfide reductase
  • length: 438
  • theoretical pI: 5.23597
  • theoretical MW: 49289.5
  • GRAVY: -0.311416

Function[edit source | edit]

  • reaction:
    EC 1.8.1.14?  ExPASy
    CoA-disulfide reductase2 CoA + NADP+ = CoA-disulfide + NADPH
  • TIGRFAM:
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 687.1)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 104.9)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 104.5)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 70.8)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 63.5)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 63.3)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 59.4)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 57.3)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 54)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 52.6)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 48.1)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 47.2)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 42.3)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 30.4)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 30.4)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 29.6)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 25.6)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 15.5)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 12.7)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 12.6)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 11.5)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 172.7)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 58.8)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 51.1)
    Reductase_C (CL0608) Pyr_redox_dim; Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain (PF02852; HMM-score: 40.4)
    NADP_Rossmann (CL0063) K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 18.4)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 16.2)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 15.6)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 15.5)
    RNase_H (CL0219) DDE_Tnp_1; Transposase DDE domain (PF01609; HMM-score: 14.1)
    NADP_Rossmann (CL0063) Shikimate_DH; Shikimate / quinate 5-dehydrogenase (PF01488; HMM-score: 13.2)
    Methyltransf_18; Methyltransferase domain (PF12847; HMM-score: 12.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.167
    • Ymax_pos: 11
    • Cmax: 0.142
    • Cmax_pos: 24
    • Smax: 0.449
    • Smax_pos: 1
    • Smean: 0.234
    • D: 0.193
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447047269 NCBI
  • RefSeq: WP_001124525 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MPKIVVVGAVAGGATCASQIRRLDKESDIIIFEKDRDMSFANCALPYVIGEVVEDRRYALAYTPEKFYDRKQITVKTYHEVIAINDERQTVSVLNRKTNEQFEESYDKLILSPGASANSLGFESDITFTLRNLEDTDAIDQFIKANQVDKVLVVGAGYVSLEVLENLYERGLHPTLIHRSDKINKLMDADMNQPILDELDKREIPYRLNEEINAINGNEITFKSGKVEHYDMIIEGVGTHPNSKFIESSNIKLDRKGFIPVNDKFETNVPNIYAIGDIATSHYRHVDLPASVPLAWGAHRAASIVAEQIAGNDTIEFKGFLGNNIVKFFDYTFASVGVKPNELKQFDYKMVEVTQGAHANYYPGNSPLHLRVYYDTSNRQILRAAAVGKEGADKRIDVLSMAMMNQLTVDELTEFEVAYAPPYSHPKDLINMIGYKAK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS04740 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]