From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS07540 [old locus tag: NWMN_1338 ]
  • pan locus tag?: SAUPAN003859000
  • symbol: NWMN_RS07540
  • pan gene symbol?: thyA
  • synonym:
  • product: thymidylate synthase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS07540 [old locus tag: NWMN_1338 ]
  • symbol: NWMN_RS07540
  • product: thymidylate synthase
  • replicon: chromosome
  • strand: -
  • coordinates: 1470645..1471601
  • length: 957
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1470645..1471601) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGTTGAATTCATTTGATGCAGCATATCACAGTCTTTGTGAAGAAGTTTTAGAAATAGGA
    AATACACGAAATGATCGCACAAATACAGGTACGATTTCGAAATTTGGTCATCAACTTCGC
    TTTGACTTATCTAAAGGATTTCCACTATTAACGACAAAGAAAGTTTCTTTTAAATTAGTA
    GCAACCGAATTATTATGGTTCATTAAAGGAGATACAAACATCCAATACTTATTAAAATAT
    AATAATAATATATGGAACGAATGGGCTTTTGAAAATTATATCAAATCAGACGAGTATAAA
    GGTCCAGATATGACAGATTTCGGGCATCGTGCATTGAGTGATCCTGAATTTAACGAACAA
    TATAAAGAACAAATGAAACAATTTAAGCAACGTATTCTTGAAGATGATACATTTGCGAAG
    CAATTCGGGGATTTAGGAAATGTTTATGGTAAACAATGGCGAGATTGGGTTGATAAAGAT
    GGTAATCATTTTGATCAACTTAAAACAGTAATTGAACAAATTAAGCATAATCCAGATTCA
    AGGCGACACATCGTATCTGCATGGAATCCAACAGAAATTGATACAATGGCACTTCCGCCT
    TGTCATACCATGTTCCAGTTTTATGTCCAAGATGGTAAGTTAAGTTGCCAGTTATACCAA
    CGTAGCGCAGATATCTTTTTAGGTGTGCCATTTAATATCGCAAGCTACGCTTTATTGACA
    CACCTTATTGCCAAAGAATGTGGACTTGAAGTGGGTGAATTTGTGCATACATTTGGAGAT
    GCACATATTTATTCAAATCATATTGATGCGATTCAAACACAATTAGCACGTGAAAGCTTC
    AATCCTCCAACATTAAAAATTAACAGTGACAAGTCTATTTTCGACATAAATTATGAAGAT
    TTGGAAATTGTTGACTATGAATCACATCCAGCAATAAAAGCTCCAATAGCAGTGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    957

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS07540 [old locus tag: NWMN_1338 ]
  • symbol: NWMN_RS07540
  • description: thymidylate synthase
  • length: 318
  • theoretical pI: 5.37393
  • theoretical MW: 36839.2
  • GRAVY: -0.488679

Function[edit source | edit]

  • reaction:
    EC 2.1.1.45?  ExPASy
    Thymidylate synthase5,10-methylenetetrahydrofolate + dUMP = dihydrofolate + dTMP
  • TIGRFAM:
    MetabolismPurines, pyrimidines, nucleosides, and nucleotides2'-Deoxyribonucleotide metabolismthymidylate synthase (TIGR03284; EC 2.1.1.45; HMM-score: 529.9)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotides2'-Deoxyribonucleotide metabolismthymidylate synthase, methanogen type (TIGR03283; EC 2.1.1.-; HMM-score: 70.8)
  • TheSEED:
  • PFAM:
    no clan definedThymidylat_synt; Thymidylate synthase (PF00303; HMM-score: 393.8)
    Nif11; Nif11 domain (PF07862; HMM-score: 16.8)
    RRM (CL0221) Tap-RNA_bind; Tap, RNA-binding (PF09162; HMM-score: 13.7)
    no clan definedLIAS_N; N-terminal domain of lipoyl synthase of Radical_SAM family (PF16881; HMM-score: 12.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_RS00925acetyl-CoA acetyltransferase  [1] (data from MRSA252)
    NWMN_RS009303-hydroxyacyl-CoA dehydrogenase  [1] (data from MRSA252)
    NWMN_RS03640LysR family transcriptional regulator  [1] (data from MRSA252)
    NWMN_RS04915NAD(+) kinase  [1] (data from MRSA252)
    NWMN_RS05380pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    NWMN_RS08930pyruvate kinase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.116
    • Ymax_pos: 26
    • Cmax: 0.105
    • Cmax_pos: 26
    • Smax: 0.173
    • Smax_pos: 18
    • Smean: 0.123
    • D: 0.118
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446857629 NCBI
  • RefSeq: WP_000934885 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MLNSFDAAYHSLCEEVLEIGNTRNDRTNTGTISKFGHQLRFDLSKGFPLLTTKKVSFKLVATELLWFIKGDTNIQYLLKYNNNIWNEWAFENYIKSDEYKGPDMTDFGHRALSDPEFNEQYKEQMKQFKQRILEDDTFAKQFGDLGNVYGKQWRDWVDKDGNHFDQLKTVIEQIKHNPDSRRHIVSAWNPTEIDTMALPPCHTMFQFYVQDGKLSCQLYQRSADIFLGVPFNIASYALLTHLIAKECGLEVGEFVHTFGDAHIYSNHIDAIQTQLARESFNPPTLKINSDKSIFDINYEDLEIVDYESHPAIKAPIAV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS07540 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 1.4 1.5

Relevant publications[edit source | edit]