From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS03640 [old locus tag: NWMN_0641 ]
  • pan locus tag?: SAUPAN002554000
  • symbol: NWMN_RS03640
  • pan gene symbol?: ccpE
  • synonym:
  • product: LysR family transcriptional regulator

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS03640 [old locus tag: NWMN_0641 ]
  • symbol: NWMN_RS03640
  • product: LysR family transcriptional regulator
  • replicon: chromosome
  • strand: +
  • coordinates: 724466..725332
  • length: 867
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (724466..725332) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGAAGATTGAAGACTATCGTTTACTAATAACATTAGACGAAACGAAAACGTTACGTAAA
    GCGGCTGAAATTTTATATATATCTCAACCTGCTGTTACACAAAGACTAAAAGCTATTGAA
    AATGCTTTTGGAGTAGATATTTTTATCAGAACAAAAAAACAATTGATTACAACAACTGAA
    GGAACAATGATTATTGAGCATGCTCGTGACATGTTGAAAAGAGAGCGATTATTTTTTGAC
    AAAATGCAGGCACATATTGGTGAAGTGAATGGAACAATATCAATCGGGTGTTCTTCTTTG
    ATTGGACAAACCTTACTTCCTGAAGTTTTGAGCCTATATAATGCCCAATTTCCTAATGTT
    GAAATACAAGTGCAAGTTGGTTCAACTGAACAAATTAAAGCAAATCATAGAGATTATCAT
    GTTATGATAACTCGTGGAAATAAGGTAATGAATTTAGCTAACACACATTTATTTAATGAT
    GATCATTATTTTATTTTTCCAAAAAATAGACGAGATGATGTTACAAAGTTACCATTTATA
    GAGTTTCAAGCTGATCCGATTTATATAAATCAAATAAAAGAATGGTATAACGATAATTTA
    GAACAAGATTACCATGCAACTATTACAGTGGATCAAGTAGCAACTTGCAAAGAAATGTTG
    ATTAGTGGTGTAGGTGTTACAATCTTGCCAGAAATTATGATGAAAAATATCAGCAAAGAA
    CAATTTGAGTTTGAAAAAGTAGAAATTGATAATGAACCGCTGATTCGTTCGACATTTATG
    AGTTATGATCCGAGCATGTTGCAATTGCCACAAGTTGATTCTTTTGTAAATCTCATGGCG
    AGCTTTGTTGAACAACCAAAGGCGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    867

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS03640 [old locus tag: NWMN_0641 ]
  • symbol: NWMN_RS03640
  • description: LysR family transcriptional regulator
  • length: 288
  • theoretical pI: 5.22005
  • theoretical MW: 33244.1
  • GRAVY: -0.219097

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionsaminoethylphosphonate catabolism associated LysR family transcriptional regulator (TIGR03339; HMM-score: 74.4)
    MetabolismEnergy metabolismOtherpca operon transcription factor PcaQ (TIGR02424; HMM-score: 54.4)
    Signal transductionRegulatory functionsDNA interactionspca operon transcription factor PcaQ (TIGR02424; HMM-score: 54.4)
    Cellular processesCellular processesToxin production and resistancetranscriptional regulator, ArgP family (TIGR03298; HMM-score: 46.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairtranscriptional regulator, ArgP family (TIGR03298; HMM-score: 46.9)
    Signal transductionRegulatory functionsDNA interactionstranscriptional regulator, ArgP family (TIGR03298; HMM-score: 46.9)
    putative choline sulfate-utilization transcription factor (TIGR03418; HMM-score: 41.2)
    Signal transductionRegulatory functionsDNA interactionsD-serine deaminase transcriptional activator (TIGR02036; HMM-score: 33)
  • TheSEED:
  • PFAM:
    PBP (CL0177) LysR_substrate; LysR substrate binding domain (PF03466; HMM-score: 83.4)
    HTH (CL0123) HTH_1; Bacterial regulatory helix-turn-helix protein, lysR family (PF00126; HMM-score: 53.8)
    HTH_30; PucR C-terminal helix-turn-helix domain (PF13556; HMM-score: 20)
    no clan definedDUF1433; Protein of unknown function (DUF1433) (PF07252; HMM-score: 15.3)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.129
    • Ymax_pos: 39
    • Cmax: 0.175
    • Cmax_pos: 39
    • Smax: 0.132
    • Smax_pos: 33
    • Smean: 0.088
    • D: 0.113
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446610065 NCBI
  • RefSeq: WP_000687411 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKIEDYRLLITLDETKTLRKAAEILYISQPAVTQRLKAIENAFGVDIFIRTKKQLITTTEGTMIIEHARDMLKRERLFFDKMQAHIGEVNGTISIGCSSLIGQTLLPEVLSLYNAQFPNVEIQVQVGSTEQIKANHRDYHVMITRGNKVMNLANTHLFNDDHYFIFPKNRRDDVTKLPFIEFQADPIYINQIKEWYNDNLEQDYHATITVDQVATCKEMLISGVGVTILPEIMMKNISKEQFEFEKVEIDNEPLIRSTFMSYDPSMLQLPQVDSFVNLMASFVEQPKA

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS03640 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]