From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS08585 [old locus tag: NWMN_1529 ]
  • pan locus tag?: SAUPAN004230000
  • symbol: NWMN_RS08585
  • pan gene symbol?:
  • synonym:
  • product: recombinase RarA

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS08585 [old locus tag: NWMN_1529 ]
  • symbol: NWMN_RS08585
  • product: recombinase RarA
  • replicon: chromosome
  • strand: +
  • coordinates: 1693438..1694712
  • length: 1275
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1693438..1694712) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    GTGAGTACAGAACCATTAGCATCGAGAATGCGCCCAAAAAATATAGATGAAATCATTTCC
    CAACAACATTTAGTTGGACCAAGAGGCATTATCAGAAGAATGGTTGATACAAAAAAATTA
    ACTTCAATGATTTTTTATGGTCCACCTGGTATAGGCAAAACAAGTATTGCCAAAGCAATT
    TCGGGCAGTACGCAATATAAATTCAGACAATTGAATGCTGTAACTAACACTAAAAAAGAT
    ATGCAACTTGTTGTTGAAGAAGCTAAAATGTCTGGTCAAGTTATCTTGTTATTAGATGAA
    ATACATCGACTAGATAAAGCTAAACAAGACTTTTTATTACCTCATTTAGAAAATGGCAAA
    ATCGTCTTGATCGGTGCTACAACTTCAAATCCTTATCATGCTATCAATCCAGCGATTCGT
    TCAAGAGCGCAAATTTTCGAGTTATATCCTTTAAATGACGAAGATGTGCGCCAAGCGTTA
    ACTCGTGCAATAGAAGATGATGAGAATGGTTTGAAAACATATCAACCCAAAATTGATGAA
    GATGCCATGACCTACTTTTCTACACAAAGCCAAGGTGATGTTCGTAGTGCGTTAAATGCA
    TTGGAATTAGCTGTATTAAGCGCAGATAATGACAAAGACGGTTATCGACATGTTACATTG
    CAAGATGCTAAAGACTGTTTACAAAAAGGTGCATTTGTAAGTGACAAGGATGGTGACATG
    CATTACGATGTTATGAGCGCTTTCCAAAAATCTATCCGTGGTAGCGACGTCAATGCCGCT
    TTACATTATTTAGCACGATTAATTGAAGCTGGAGATTTACCTACAATAGTTCGACGATTA
    CTTGTAATTAGCTATGAGGATATAGGCTTAGCCTCACCTAATGCTGGTCAGAGAACACTT
    GCTGCTATTGAATCAGCAGAACGTCTAGGTTTACCAGAAGCTAGAATTCCACTAAGCCAA
    GCAGTAATCGAACTATGCTTATCACCTAAGTCAAATTCAGCAATGAGTGCCATTGATAGT
    GCATTGTCCGATATTAGAAACGGTCATGTGGGCCAAATTCCAAACCATTTAAAAGATGGA
    CATTATCAAGGTGCTAAAGATCTAGGCCGATCTATTGGTTACAAATATCCACACCAATAT
    GTTAATGGCTATGTTTCACAGCAATATTTACCTGATAAACTAAAAAACAAAATTTATTAC
    GAACCAAAAACGACATCTAAAAGTGAACAACAACTCAAAGAAATATATAACAACTTACTT
    AAACAAAGGCCGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1275

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS08585 [old locus tag: NWMN_1529 ]
  • symbol: NWMN_RS08585
  • description: recombinase RarA
  • length: 424
  • theoretical pI: 8.51483
  • theoretical MW: 47250.5
  • GRAVY: -0.452123

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 68.7)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 47.7)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 47.7)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 45.1)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 34.7)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 34.7)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, delta' subunit (TIGR00678; EC 2.7.7.7; HMM-score: 34)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDnaA regulatory inactivator Hda (TIGR03420; HMM-score: 30.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairorc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 25.6)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease ATP-binding subunit ClpA (TIGR02639; HMM-score: 25.1)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesendopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 23.6)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent chaperone protein ClpB (TIGR03346; HMM-score: 20.8)
    AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 19.9)
    Cellular processesCellular processesCell divisionATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 18.7)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 18.7)
    26S proteasome subunit P45 family (TIGR01242; HMM-score: 18.5)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesproteasome ATPase (TIGR03689; EC 3.6.4.8; HMM-score: 18)
    putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 16.5)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 16)
    Genetic information processingMobile and extrachromosomal element functionsProphage functionsphage nucleotide-binding protein (TIGR01618; HMM-score: 14.9)
    Cellular processesCellular processesSporulation and germinationstage V sporulation protein K (TIGR02881; HMM-score: 14.9)
    Cellular processesCellular processesOthergas vesicle protein GvpN (TIGR02640; HMM-score: 14.8)
    Genetic information processingDNA metabolismDNA replication, recombination, and repaircheckpoint protein rad24 (TIGR00602; HMM-score: 13.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA replication and repair protein RecF (TIGR00611; HMM-score: 13.9)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsadenylate kinase (TIGR01351; EC 2.7.4.-; HMM-score: 12.9)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesputative ATP-dependent protease (TIGR00764; HMM-score: 12.4)
    Unknown functionGeneralMg chelatase-like protein (TIGR00368; HMM-score: 11.7)
  • TheSEED:
  • PFAM:
    post-AAA (CL0604) MgsA_C; MgsA AAA+ ATPase C terminal (PF12002; HMM-score: 216.6)
    no clan definedAAA_assoc_2; AAA C-terminal domain (PF16193; HMM-score: 85.6)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 61.4)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 51.4)
    AAA_14; AAA domain (PF13173; HMM-score: 28.6)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 28.4)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 25.6)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 24.5)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 20.8)
    DNA_pol3_delta2; DNA polymerase III, delta subunit (PF13177; HMM-score: 20.6)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 19.8)
    AAA_22; AAA domain (PF13401; HMM-score: 19.6)
    Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 19.3)
    ABC_tran; ABC transporter (PF00005; HMM-score: 19.3)
    Rad17; Rad17 cell cycle checkpoint protein (PF03215; HMM-score: 17.8)
    AAA_18; AAA domain (PF13238; HMM-score: 16.7)
    AAA_19; AAA domain (PF13245; HMM-score: 16.6)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 15.8)
    AAA_3; ATPase family associated with various cellular activities (AAA) (PF07726; HMM-score: 15.5)
    AAA_24; AAA domain (PF13479; HMM-score: 14.1)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 14.1)
    no clan definedLXG; LXG domain of WXG superfamily (PF04740; HMM-score: 14)
    P-loop_NTPase (CL0023) Parvo_NS1; Parvovirus non-structural protein NS1 (PF01057; HMM-score: 13.8)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 13.1)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 13)
    AAA_2; AAA domain (Cdc48 subfamily) (PF07724; HMM-score: 12.7)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 12.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_RS02025single-stranded DNA-binding protein  [1] (data from MRSA252)
    NWMN_RS0291550S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_RS02960elongation factor G  [1] (data from MRSA252)
    NWMN_RS02965elongation factor Tu  [1] (data from MRSA252)
    NWMN_RS04590NADH dehydrogenase  [1] (data from MRSA252)
    NWMN_RS05380pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    NWMN_RS05385pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    NWMN_RS05390dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    NWMN_RS05395dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    NWMN_RS0649050S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_RS07455dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    NWMN_RS074602-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    NWMN_RS07605serine/threonine dehydratase  [1] (data from MRSA252)
    NWMN_RS08350molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_RS0868550S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_RS08930pyruvate kinase  [1] (data from MRSA252)
    NWMN_RS08995universal stress protein UspA  [1] (data from MRSA252)
    NWMN_RS11720fructose-bisphosphate aldolase  [1] (data from MRSA252)
    NWMN_RS1233050S ribosomal protein L15  [1] (data from MRSA252)
    NWMN_RS1234030S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_RS1242550S ribosomal protein L3  [1] (data from MRSA252)
    NWMN_RS14560arginine deiminase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.143
    • Ymax_pos: 60
    • Cmax: 0.149
    • Cmax_pos: 60
    • Smax: 0.171
    • Smax_pos: 1
    • Smean: 0.111
    • D: 0.131
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446024880 NCBI
  • RefSeq: WP_000102735 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MSTEPLASRMRPKNIDEIISQQHLVGPRGIIRRMVDTKKLTSMIFYGPPGIGKTSIAKAISGSTQYKFRQLNAVTNTKKDMQLVVEEAKMSGQVILLLDEIHRLDKAKQDFLLPHLENGKIVLIGATTSNPYHAINPAIRSRAQIFELYPLNDEDVRQALTRAIEDDENGLKTYQPKIDEDAMTYFSTQSQGDVRSALNALELAVLSADNDKDGYRHVTLQDAKDCLQKGAFVSDKDGDMHYDVMSAFQKSIRGSDVNAALHYLARLIEAGDLPTIVRRLLVISYEDIGLASPNAGQRTLAAIESAERLGLPEARIPLSQAVIELCLSPKSNSAMSAIDSALSDIRNGHVGQIPNHLKDGHYQGAKDLGRSIGYKYPHQYVNGYVSQQYLPDKLKNKIYYEPKTTSKSEQQLKEIYNNLLKQRP

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS08585 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]