From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0569 [new locus tag: SA_RS03290 ]
  • pan locus tag?: SAUPAN002479000
  • symbol: SA0569
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0569 [new locus tag: SA_RS03290 ]
  • symbol: SA0569
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 662818..663618
  • length: 801
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGGATCTATTTACTAGAAAAGATGGAACATCGATACATTACAGTACATTAGGTGAAGGC
    TATCCTATCGTATTGATTCATACTGTACTTGATAATTATTCTGTGTTTAATAAATTAGCA
    GCACAATTAGCAAAATCATTTCAAGTTGTGTTAATTGATTTACGTGGACATGGCTATTCT
    GATAAACCTCGTCACATTGAAATAAAAGATTTTTCTGATGACATTGTTGAATTACTTAAA
    TATTTATACATTGAAGAAGTTGCATTTGTATGCCATGAAATGGGTGGAATCATTGGTGCG
    GATATTTCAGTACGTTATCCTGAATTTACATCATCACTTATGTTGGTAAATCCAACATCT
    ATTGAAGGTGAATTACCGGAAGAACGTTTATTTAGAAAATATGCCCATATTATTCGAAAC
    TGGGATCCTGAAAAACAAGATAAATTTTTAAATAAGCGTAAGTATTATCGTCCGAGAAAA
    ATGAATCGATTCCTTAAACATGTCGTAGATACAAATGAAATATCAACTAAAGAAGAAATT
    CAAGCAGTTAAAGAGGTATTCAAAAACGCTGATATTTCTCAAACTTATAGAAATGTCGTA
    GTACCGACAAAAATTATTGCAGGAGAATTCGGTGAAAGAACAACAAGATTGGAAGCTAAA
    GAAGTAGCTGATTTAATCCAAAATGCGGACTTTGAAGTATATCAAGAATCAAGTGCATTC
    CCATTTGTTGAAGAGCAAGAAAGATTCGTCGAAGATATAGCTTCATTTATCAACAAACAT
    CACGATGAAAAGCATGTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    801

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0569 [new locus tag: SA_RS03290 ]
  • symbol: SA0569
  • description: hypothetical protein
  • length: 266
  • theoretical pI: 5.81589
  • theoretical MW: 30982
  • GRAVY: -0.413534

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismEnergy metabolismOther3-oxoadipate enol-lactonase (TIGR02427; EC 3.1.1.24; HMM-score: 84.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersBiotinpimelyl-[acyl-carrier protein] methyl ester esterase (TIGR01738; EC 3.1.1.85; HMM-score: 59.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (TIGR03695; EC 4.2.99.20; HMM-score: 54.1)
    proline-specific peptidase (TIGR01250; HMM-score: 53.8)
    pyrimidine utilization protein D (TIGR03611; HMM-score: 42.9)
    MetabolismEnergy metabolismPhotosynthesisputative magnesium chelatase accessory protein (TIGR03056; HMM-score: 33.6)
    2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase (TIGR03343; EC 3.7.1.-; HMM-score: 22.1)
    MetabolismEnergy metabolismOtherpoly(3-hydroxyalkanoate) depolymerase (TIGR02240; EC 3.1.1.-; HMM-score: 12.6)
  • TheSEED:  
    Predicted hydrolase 
  • PFAM:
    AB_hydrolase (CL0028) Abhydrolase_1; alpha/beta hydrolase fold (PF00561; HMM-score: 53.9)
    Hydrolase_4; Serine aminopeptidase, S33 (PF12146; HMM-score: 48.5)
    Abhydrolase_6; Alpha/beta hydrolase family (PF12697; HMM-score: 34.8)
    Thioesterase; Thioesterase domain (PF00975; HMM-score: 13.9)
    Ndr; Ndr family (PF03096; HMM-score: 13.6)
    PDDEXK (CL0236) RE_HindIII; HindIII restriction endonuclease (PF09518; HMM-score: 13.3)
    PUP (CL0408) POC1; POC1 chaperone (PF10450; HMM-score: 13.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.89
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.108
    • Ymax_pos: 49
    • Cmax: 0.113
    • Cmax_pos: 41
    • Smax: 0.139
    • Smax_pos: 45
    • Smean: 0.083
    • D: 0.098
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MDLFTRKDGTSIHYSTLGEGYPIVLIHTVLDNYSVFNKLAAQLAKSFQVVLIDLRGHGYSDKPRHIEIKDFSDDIVELLKYLYIEEVAFVCHEMGGIIGADISVRYPEFTSSLMLVNPTSIEGELPEERLFRKYAHIIRNWDPEKQDKFLNKRKYYRPRKMNRFLKHVVDTNEISTKEEIQAVKEVFKNADISQTYRNVVVPTKIIAGEFGERTTRLEAKEVADLIQNADFEVYQESSAFPFVEEQERFVEDIASFINKHHDEKHV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]