From AureoWiki
(Redirected from SA0943.1)
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0943-1 [new locus tag: SA_RS05350 ]
  • pan locus tag?: SAUPAN003317000
  • symbol: pdhA
  • pan gene symbol?: pdhA
  • synonym:
  • product: pyruvate dehydrogenase E1 component subunit alpha

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0943-1 [new locus tag: SA_RS05350 ]
  • symbol: pdhA
  • product: pyruvate dehydrogenase E1 component subunit alpha
  • replicon: chromosome
  • strand: +
  • coordinates: 1070842..1071954
  • length: 1113
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGGCTCCTAAGTTACAAGCCCAATTCGATGCAGTAAAAGTTTTAAATGATACTCAATCG
    AAATTTGAAATGGTTCAAATTTTGGATGAGAATGGTAACGTCGTAAATGAAGACTTAGTA
    CCTGATCTTACGGATGAACAATTAGTAGAATTAATGGAAAGAATGGTATGGACTCGTATC
    CTTGATCAACGTTCTATCTCATTAAACAGACAAGGACGTTTAGGTTTCTATGCACCAACT
    GCTGGTCAAGAAGCATCACAATTAGCGTCACAATACGCTTTAGAAAAAGAAGATTACATT
    TTACCGGGATACAGAGATGTTCCTCAAATTATTTGGCATGGTTTACCATTAACTGAAGCT
    TTCTTATTCTCAAGAGGTCACTTCAAAGGAAATCAATTCCCTGAAGGCGTTAATGCATTG
    AGCCCACAAATTATTATCGGTGCACAATACATTCAAGCTGCTGGTGTTGCATTTGCACTT
    AAAAAACGTGGTAAAAATGCAGTTGCAATCACTTACACTGGTGACGGTGGTTCTTCACAA
    GGTGATTTCTACGAAGGTATTAACTTTGCAGCAGCTTATAAAGCACCTGCAATTTTCGTT
    ATTCAAAACAATAACTATGCAATTTCAACACCAAGAAGCAAGCAAACTGCTGCTGAAACA
    TTAGCTCAAAAAGCAATTGCTGTAGGTATTCCTGGTATCCAAGTTGATGGTATGGATGCG
    TTAGCTGTATATCAAGCAACTAAAGAAGCACGTGACCGCGCAGTTGCAGGTGAAGGTCCA
    ACATTAATTGAAACTATGACATATCGTTATGGTCCTCATACAATGGCTGGTGACGATCCA
    ACTCGTTACAGAACTTCAGACGAAGATGCTGAATGGGAGAAAAAAGACCCATTAGTACGT
    TTCCGTAAATTCCTTGAAAACAAAGGTTTATGGAATGAAGACAAAGAAAATGAAGTTATT
    GAACGTGCAAAAGCTGATATTAAAGCAGCAATTAAAGAGGCTGATAACACTGAAAAACAA
    ACTGTTACTTCTCTAATGGAAATTATGTATGAAGATATGCCTCAAAACTTAGCAGAACAA
    TATGAAATTTACAAAGAGAAGGAGTCGAAGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1113

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0943-1 [new locus tag: SA_RS05350 ]
  • symbol: PdhA
  • description: pyruvate dehydrogenase E1 component subunit alpha
  • length: 370
  • theoretical pI: 4.62739
  • theoretical MW: 41382.3
  • GRAVY: -0.484054

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismEnergy metabolismPyruvate dehydrogenasepyruvate dehydrogenase (acetyl-transferring) E1 component, alpha subunit (TIGR03181; EC 1.2.4.1; HMM-score: 488)
    MetabolismEnergy metabolismPyruvate dehydrogenasepyruvate dehydrogenase (acetyl-transferring) E1 component, alpha subunit (TIGR03182; EC 1.2.4.1; HMM-score: 217.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOther1-deoxy-D-xylulose-5-phosphate synthase (TIGR00204; EC 2.2.1.7; HMM-score: 21.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamine1-deoxy-D-xylulose-5-phosphate synthase (TIGR00204; EC 2.2.1.7; HMM-score: 21.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridoxine1-deoxy-D-xylulose-5-phosphate synthase (TIGR00204; EC 2.2.1.7; HMM-score: 21.6)
    MetabolismEnergy metabolismTCA cycleoxoglutarate dehydrogenase (succinyl-transferring), E1 component (TIGR00239; EC 1.2.4.2; HMM-score: 16.7)
  • TheSEED:  
    CarbohydratesCentral carbohydrate metabolismDehydrogenase complexes Pyruvate dehydrogenase E1 component alpha subunit (EC 1.2.4.1) 
    Central carbohydrate metabolismPyruvate metabolism II: acetyl-CoA, acetogenesis from pyruvate Pyruvate dehydrogenase E1 component alpha subunit (EC 1.2.4.1) 
  • PFAM:
    THDP-binding (CL0254) E1_dh; Dehydrogenase E1 component (PF00676; HMM-score: 345.3)
    DXP_synthase_N; 1-deoxy-D-xylulose-5-phosphate synthase (PF13292; HMM-score: 21.7)
    TPP_enzyme_C; Thiamine pyrophosphate enzyme, C-terminal TPP binding domain (PF02775; HMM-score: 18.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA0033(aadD)kanamycin nucleotidyltransferase  [1] (data from MRSA252)
    SA2428(arcA)arginine deiminase  [1] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [1] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SA0505(fus)elongation factor G  [1] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [1] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [1] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SA2047(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SA1100(tsf)elongation factor Ts  [1] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [1] (data from MRSA252)
    SA0627hypothetical protein  [1] (data from MRSA252)
    SA0829hypothetical protein  [1] (data from MRSA252)
    SA1532hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.115
    • Ymax_pos: 31
    • Cmax: 0.113
    • Cmax_pos: 21
    • Smax: 0.16
    • Smax_pos: 22
    • Smean: 0.109
    • D: 0.112
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 29165620 NCBI
  • RefSeq: NP_808209 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MAPKLQAQFDAVKVLNDTQSKFEMVQILDENGNVVNEDLVPDLTDEQLVELMERMVWTRILDQRSISLNRQGRLGFYAPTAGQEASQLASQYALEKEDYILPGYRDVPQIIWHGLPLTEAFLFSRGHFKGNQFPEGVNALSPQIIIGAQYIQAAGVAFALKKRGKNAVAITYTGDGGSSQGDFYEGINFAAAYKAPAIFVIQNNNYAISTPRSKQTAAETLAQKAIAVGIPGIQVDGMDALAVYQATKEARDRAVAGEGPTLIETMTYRYGPHTMAGDDPTRYRTSDEDAEWEKKDPLVRFRKFLENKGLWNEDKENEVIERAKADIKAAIKEADNTEKQTVTSLMEIMYEDMPQNLAEQYEIYKEKESK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33

Relevant publications[edit source | edit]