From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1043 [new locus tag: SA_RS05930 ]
  • pan locus tag?: SAUPAN003480000
  • symbol: pyrB
  • pan gene symbol?: pyrB
  • synonym:
  • product: aspartate carbamoyltransferase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1043 [new locus tag: SA_RS05930 ]
  • symbol: pyrB
  • product: aspartate carbamoyltransferase
  • replicon: chromosome
  • strand: +
  • coordinates: 1179863..1180744
  • length: 882
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGAATCATTTATTATCAATGGAACATTTATCTACAGATCAAATATACAAACTTATCCAA
    AAGGCAAGTCAATTTAAATCTGGTGAACGTCAACTACCAAACTTTGAAGGGAAATATGTC
    GCAAATTTATTCTTTGAAAATTCTACTCGAACAAAATGTAGTTTTGAAATGGCAGAACTT
    AAGCTAGGGTTAAAAACGATTAGCTTTGAAACATCAACATCATCTGTTTCAAAAGGTGAA
    TCTTTATATGACACATGTAAAACTTTAGAAAGTATTGGCTGTGATTTATTAGTCATTAGA
    CATCCGTTTAATAACTACTATGAAAAATTAGCGAATATTAACATCCCAATTGCGAATGCT
    GGTGATGGTAGTGGACAACATCCAACACAAAGTTTACTTGATTTAATGACGATATATGAA
    GAATATGGATATTTTGAAGGCTTGAATGTATTGATTTGTGGAGACATTAAAAATTCACGT
    GTCGCACGTAGTAATTACCATAGTTTAAAAGCATTAGGTGCAAACGTAATGTTTAATAGC
    CCAAATGCTTGGATTGATGATTCTTTAGAAGCACCTTATGTAAATATAGATGATGTTATA
    GAAACAGTAGATATAGTTATGTTATTAAGAATTCAACATGAAAGACATGGGCTTGCAGAA
    GAAACTAGATTTGCAGCAGATGATTATCATCAAAAGCATGGCTTAAATGAAGTGCGCTAT
    AACAAATTACAAGAACATGCTATTGTTATGCATCCGGCACCTGTGAATAGAGGAGTAGAA
    ATACAAAGCGATTTAGTAGAAGCTTCAAAATCAAGAATTTTTAAGCAAATGGAAAATGGC
    GTTTACTTAAGAATGGCAGTCATTGATGAATTATTAAAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    882

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1043 [new locus tag: SA_RS05930 ]
  • symbol: PyrB
  • description: aspartate carbamoyltransferase
  • length: 293
  • theoretical pI: 5.76441
  • theoretical MW: 33257.5
  • GRAVY: -0.323549

Function[edit source | edit]

  • reaction:
    EC 2.1.3.2?  ExPASy
    Aspartate carbamoyltransferaseCarbamoyl phosphate + L-aspartate = phosphate + N-carbamoyl-L-aspartate
  • TIGRFAM:
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPyrimidine ribonucleotide biosynthesisaspartate carbamoyltransferase (TIGR00670; EC 2.1.3.2; HMM-score: 305)
    MetabolismAmino acid biosynthesisGlutamate familyornithine carbamoyltransferase (TIGR00658; EC 2.1.3.3; HMM-score: 138.8)
    MetabolismEnergy metabolismAmino acids and aminesputrescine carbamoyltransferase (TIGR04384; EC 2.1.3.6; HMM-score: 70.8)
    knotted carbamoyltransferase YgeW (TIGR03316; EC 2.1.3.-; HMM-score: 26.3)
  • TheSEED:  
    Nucleosides and NucleotidesPyrimidinesDe Novo Pyrimidine Synthesis Aspartate carbamoyltransferase (EC 2.1.3.2) 
  • PFAM:
    no clan definedOTCace_N; Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain (PF02729; HMM-score: 149.4)
    Asp-glut_race (CL0399) OTCace; Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain (PF00185; HMM-score: 70.1)
    NADP_Rossmann (CL0063) 2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 13.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.125
    • Ymax_pos: 26
    • Cmax: 0.109
    • Cmax_pos: 22
    • Smax: 0.207
    • Smax_pos: 21
    • Smean: 0.136
    • D: 0.129
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNHLLSMEHLSTDQIYKLIQKASQFKSGERQLPNFEGKYVANLFFENSTRTKCSFEMAELKLGLKTISFETSTSSVSKGESLYDTCKTLESIGCDLLVIRHPFNNYYEKLANINIPIANAGDGSGQHPTQSLLDLMTIYEEYGYFEGLNVLICGDIKNSRVARSNYHSLKALGANVMFNSPNAWIDDSLEAPYVNIDDVIETVDIVMLLRIQHERHGLAEETRFAADDYHQKHGLNEVRYNKLQEHAIVMHPAPVNRGVEIQSDLVEASKSRIFKQMENGVYLRMAVIDELLK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: PyrR
    PyrR (RNA) important in Pyrimidine metabolism

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]