From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1128 [new locus tag: SA_RS06375 ]
  • pan locus tag?: SAUPAN003587000
  • symbol: recA
  • pan gene symbol?: recA
  • synonym:
  • product: recombinase A

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1128 [new locus tag: SA_RS06375 ]
  • symbol: recA
  • product: recombinase A
  • replicon: chromosome
  • strand: +
  • coordinates: 1280570..1281613
  • length: 1044
  • essential: yes DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    TTGGATAACGATCGTCAAAAAGCTTTAGATACAGTAATTAAAAATATGGAGAAATCTTTC
    GGTAAAGGTGCCGTAATGAAGTTGGGTGACAATATAGGTCGCCGAGTTTCAACTACATCA
    ACTGGTTCAGTTACATTAGATAATGCGCTAGGTGTAGGTGGCTATCCTAAAGGACGAATT
    ATTGAAATTTATGGTCCTGAAAGTTCTGGTAAGACAACAGTAGCGCTTCACGCTATTGCT
    GAAGTACAAAGTAATGGCGGGGTGGCAGCATTTATCGATGCTGAACATGCTTTAGATCCA
    GAATATGCTCAAGCATTAGGCGTAGATATCGATAATTTATATTTATCGCAACCGGATCAT
    GGTGAACAAGGTCTTGAAATCGCCGAAGCATTTGTTAGAAGTGGTGCAGTTGATATTGTA
    GTTGTAGACTCAGTTGCTGCTTTAACACCTAAAGCTGAAATTGAAGGAGAAATGGGAGAC
    ACTCACGTTGGTTTACAAGCTCGTTTAATGTCACAAGCGTTACGTAAACTTTCAGGTGCT
    ATTTCTAAATCAAATACAACTGCTATTTTCATCAACCAAATTCGTGAAAAAGTTGGTGTT
    ATGTTCGGTAATCCAGAGACTACACCAGGTGGACGTGCATTAAAATTCTATAGTTCAGTA
    AGACTAGAAGTACGTCGTGCAGAACAGCTTAAACAAGGACAAGAAATTGTAGGTAATAGA
    ACTAAAATTAAAGTCGTTAAAAATAAAGTGGCACCACCATTTAGAGTAGCTGAAGTTGAT
    ATTATGTATGGACAAGGTATTTCTAAAGAGGGTGAACTTATTGATTTAGGTGTTGAAAAC
    GACATCGTTGATAAATCAGGAGCATGGTATTCTTACAATGGCGAACGAATGGGTCAAGGT
    AAGGAAAATGTTAAAATGTACTTGAAAGAAAATCCACAAATTAAAGAAGAAATTGATCGT
    AAATTGAGAGAAAAATTAGGTATATCTGATGGTGATGTTGAAGAAACAGAAGATGCACCA
    AAGTCATTATTTGACGAAGAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1044

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1128 [new locus tag: SA_RS06375 ]
  • symbol: RecA
  • description: recombinase A
  • length: 347
  • theoretical pI: 4.85109
  • theoretical MW: 37656.3
  • GRAVY: -0.398847

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairprotein RecA (TIGR02012; HMM-score: 565.3)
    DNA repair and recombination protein RadB (TIGR02237; HMM-score: 60.3)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA repair and recombination protein RadA (TIGR02236; HMM-score: 41.2)
    meiotic recombinase Dmc1 (TIGR02238; HMM-score: 36.9)
    DNA repair protein RAD51 (TIGR02239; HMM-score: 31.4)
    KaiC domain protein, PAE1156 family (TIGR03881; HMM-score: 20.6)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA repair protein RadA (TIGR00416; HMM-score: 16.5)
    KaiC domain protein, AF_0351 family (TIGR03880; HMM-score: 16.2)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 14)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 12.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme Aphosphopantothenoylcysteine decarboxylase / phosphopantothenate--cysteine ligase (TIGR00521; EC 4.1.1.36,6.3.2.5; HMM-score: 11.4)
    putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 10.5)
  • TheSEED:  
    DNA MetabolismDNA repairDNA repair, bacterial RecFOR pathway RecA protein 
    DNA repairDNA repair, bacterial UmuCD system RecA protein 
    DNA repairDNA repair, bacterial RecA protein 
    DNA replicationDNA-replication RecA protein 
    CBSS-257314.1.peg.676 RecA protein 
  • PFAM:
    P-loop_NTPase (CL0023) RecA; recA bacterial DNA recombination protein (PF00154; HMM-score: 473.1)
    Rad51; Rad51 (PF08423; HMM-score: 44.4)
    ATPase; KaiC (PF06745; HMM-score: 36.4)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 20.3)
    AAA_24; AAA domain (PF13479; HMM-score: 16.3)
    AAA_25; AAA domain (PF13481; HMM-score: 16.2)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 15.7)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 13.4)
    H-int (CL0363) PT-HINT; Pretoxin HINT domain (PF07591; HMM-score: 13.2)
    P-loop_NTPase (CL0023) CobU; Cobinamide kinase / cobinamide phosphate guanyltransferase (PF02283; HMM-score: 13)
    NADP_Rossmann (CL0063) DFP; DNA / pantothenate metabolism flavoprotein (PF04127; HMM-score: 12.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA0505(fus)elongation factor G  [1] (data from MRSA252)
    SA1510(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA0454(purR)pur operon repressor  [1] (data from MRSA252)
    SA1532hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.143
    • Ymax_pos: 52
    • Cmax: 0.149
    • Cmax_pos: 52
    • Smax: 0.188
    • Smax_pos: 49
    • Smean: 0.148
    • D: 0.145
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MDNDRQKALDTVIKNMEKSFGKGAVMKLGDNIGRRVSTTSTGSVTLDNALGVGGYPKGRIIEIYGPESSGKTTVALHAIAEVQSNGGVAAFIDAEHALDPEYAQALGVDIDNLYLSQPDHGEQGLEIAEAFVRSGAVDIVVVDSVAALTPKAEIEGEMGDTHVGLQARLMSQALRKLSGAISKSNTTAIFINQIREKVGVMFGNPETTPGGRALKFYSSVRLEVRRAEQLKQGQEIVGNRTKIKVVKNKVAPPFRVAEVDIMYGQGISKEGELIDLGVENDIVDKSGAWYSYNGERMGQGKENVKMYLKENPQIKEEIDRKLREKLGISDGDVEETEDAPKSLFDEE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: LexA
    LexA (TF) important in SOS response  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 1.4

Relevant publications[edit source | edit]