From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1564 [new locus tag: SACOL_RS07965 ]
  • pan locus tag?: SAUPAN004074000
  • symbol: recN
  • pan gene symbol?: recN
  • synonym:
  • product: DNA repair protein RecN

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1564 [new locus tag: SACOL_RS07965 ]
  • symbol: recN
  • product: DNA repair protein RecN
  • replicon: chromosome
  • strand: -
  • coordinates: 1600106..1601785
  • length: 1680
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    ATGTTACAAACCTTATCAATCAAGCAATTTGCTATTATTGAAGAATTAGAAATTCAATTT
    TCTGATGGTTTAACTGTTTTAAGTGGTGAAACGGGTTCAGGTAAGTCAATTATTATAGAT
    GCAATTGGACAATTAATTGGAATGAGAGCTTCATCTGATTTTGTAAGACATGGTGAAAAA
    AAGGCTGTCATCGAAGGTATATTTGATATTGACGAGAGTAAAGATGCTATACATATATTG
    AAAAATATGGATATTGATGTAGATGAAGATTTTTTATTAGTTAAACGGGAAATTTTCAGC
    TCTGGTAAAAGTCTTTGTAAAATTAATAATCAAACAGTTACTTTACAAGATTTACGAAAA
    GTTATGCAAGAATTATTAGATATTCATGGCCAACATGAAACGCAGTCTTTGTTGAAACAA
    AAATACCATTTAACATTATTGGATAATTACGCAGAATCACGTTATCAAGATTTGTTGGAT
    AAATATCACCAAACTTTTCAAAATTATAAAGCCAAAAAGCAAGAGTTAGAAGATTTAGAA
    TCAGCAGACCAAGCATTGCTACAGCGTTTAGATTTAATGAAATTCCAATTAGAAGAATTG
    TCTGAAGCACATCTAAAAGAAGGCGAAATAGAGCAACTTGAAATAGATATTAAACGCATT
    CAAAACTCTGAAAAATTAAGCTTAGCGCTTAATAACGCACATATGACATTAACGGATGAA
    AATGCTATCACTGATCGTTTATATGAACTAAGCAACCATTTGTTAACAATAAACGATATA
    GTTCCAAACAAATATGACAAATTAAAAGAAGATATTGATCAATTTTACTACATTTTAGAA
    GATGCAAAACATGAGTTATATGATGAAATGGCTAATACAGAATTCGACGAACAAGTGTTA
    AACGAGTATGAATCTCGTATGAATTTGCTGAATAATTTAAAACGTAAATATGGAAAAGAT
    ATTTCAGAATTAATCGCATATCAAGAAAAGCTTAATAATGAAATCAATAAAATTGAAAAC
    TATGAACAAAGTACATCGCAGTTACGAGAAGAAATAAATGCATTGTATAATCAAGTTATA
    GAGGTTGGACAAGCGTTATCAAAGCAGCGTCGTATAGTCGCTAGGGAGTTAAGAGACCAC
    ATTGTATCGGAAATTCAAAACTTACAAATGAAAGACGCAAATCTTGAGATTTCATTTAAA
    AAATTAGAAGAACCGAATATTGATGGAATCGAATTTGTAGAATTTTTAATCAGTCCAAAT
    AAAGGGGAACCATTAAAAAGTTTAAATAAAATTGCGTCAGGTGGAGAACTTTCTAGAATT
    ATGTTAGCGTTAAAAAGTATTTTTGTTAAATCGAGAGGTCAAACTGCAATTTTATTCGAT
    GAGGTTGACTCAGGTGTATCTGGACAAGCTGCACAAAAAATGGCAGAGAAAATGCGAGAT
    ATAGCAGAATATATACAAGTTATTTGTATCTCTCACTTACCACAAGTTGCATCGATGAGC
    GACCATCATTTATTAATTTCGAAATCATCAAAAGATGATCGTACAACAACACAAGTTCAA
    GAGTTAATTAGCGATGATAAAGTAGATGAAATTGCACGAATGATTTCAGGTGCAAGTGTT
    ACTGATTTAACTCGAGAAAATGCAAGAGAAATGATACAACACAATCAAAGACGTAGATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1564 [new locus tag: SACOL_RS07965 ]
  • symbol: RecN
  • description: DNA repair protein RecN
  • length: 559
  • theoretical pI: 4.73168
  • theoretical MW: 64295.4
  • GRAVY: -0.502147

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA repair protein RecN (TIGR00634; HMM-score: 546)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02169; HMM-score: 45.5)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02169; HMM-score: 45.5)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA replication and repair protein RecF (TIGR00611; HMM-score: 28.7)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 23.1)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02168; HMM-score: 21.2)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02168; HMM-score: 21.2)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 13.3)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 8.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMolybdopterinMoaD family protein (TIGR01687; HMM-score: 6.7)
    MetabolismTransport and binding proteinsCations and iron carrying compoundspotassium uptake protein (TIGR00794; HMM-score: 6.1)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion membrane fusion protein, HlyD family (TIGR01843; HMM-score: 4.2)
    thiazole/oxazole-forming peptide maturase, SagD family component (TIGR03604; HMM-score: 3.4)
  • TheSEED:  
    DNA MetabolismDNA repairDNA repair, bacterial DNA repair protein RecN 
    DNA replicationDNA-replication DNA repair protein RecN 
  • PFAM:
    P-loop_NTPase (CL0023) SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 72.4)
    AAA_23; AAA domain (PF13476; HMM-score: 51.7)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 27.7)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 24.5)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 22.9)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 15.4)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 13.1)
    AAA_22; AAA domain (PF13401; HMM-score: 12.3)
    GH57_38_middle (CL0599) DUF1957; Domain of unknown function (DUF1957) (PF09210; HMM-score: 11)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL1741(icd)isocitrate dehydrogenase  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SACOL2104(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL1594glycine dehydrogenase subunit 1  [1] (data from MRSA252)
    SACOL1759universal stress protein  [1] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.113
    • Ymax_pos: 24
    • Cmax: 0.126
    • Cmax_pos: 51
    • Smax: 0.139
    • Smax_pos: 18
    • Smean: 0.107
    • D: 0.11
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MLQTLSIKQFAIIEELEIQFSDGLTVLSGETGSGKSIIIDAIGQLIGMRASSDFVRHGEKKAVIEGIFDIDESKDAIHILKNMDIDVDEDFLLVKREIFSSGKSLCKINNQTVTLQDLRKVMQELLDIHGQHETQSLLKQKYHLTLLDNYAESRYQDLLDKYHQTFQNYKAKKQELEDLESADQALLQRLDLMKFQLEELSEAHLKEGEIEQLEIDIKRIQNSEKLSLALNNAHMTLTDENAITDRLYELSNHLLTINDIVPNKYDKLKEDIDQFYYILEDAKHELYDEMANTEFDEQVLNEYESRMNLLNNLKRKYGKDISELIAYQEKLNNEINKIENYEQSTSQLREEINALYNQVIEVGQALSKQRRIVARELRDHIVSEIQNLQMKDANLEISFKKLEEPNIDGIEFVEFLISPNKGEPLKSLNKIASGGELSRIMLALKSIFVKSRGQTAILFDEVDSGVSGQAAQKMAEKMRDIAEYIQVICISHLPQVASMSDHHLLISKSSKDDRTTTQVQELISDDKVDEIARMISGASVTDLTRENAREMIQHNQRRR

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4]
    quantitative data / protein copy number per cell: 166 [5]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: ArgR
    ArgR (TF) important in Arginine biosynthesis, Arginine degradationRegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: 74.78 h [6]

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  6. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol. Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]