From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2653 [new locus tag: SACOL_RS13895 ]
  • pan locus tag?: SAUPAN006359000
  • symbol: SACOL2653
  • pan gene symbol?: arcR
  • synonym:
  • product: Crp/FNR family transcriptional regulator

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2653 [new locus tag: SACOL_RS13895 ]
  • symbol: SACOL2653
  • product: Crp/FNR family transcriptional regulator
  • replicon: chromosome
  • strand: -
  • coordinates: 2714127..2714813
  • length: 687
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    TTGGGTAGAAATAATAAATTAGAACATGAACTAAAGGCATTAGCAGATTACATTAATATA
    CCATATAGTATATTACAACCATATCAAAGTGAATGTTTTGTCAGACATTATACGAAAGGC
    CAAGTTATTTATTTTTCGCCACAAGAAAGTAGCAATATTTACTTTTTAATTGAAGGTAAC
    ATTATTAGAGAACATTACAATCAAAATGGAGATGTATATCGTTATTTTAATAAAGAGCAA
    GTATTATTTCCAATCAGTAACTTATTTCATCCGAAAGAGGTTAACGAATTGTGTACAGCA
    TTAACCGATTGTACAGTTCTTGGATTGCCTAGAGAATTGATGGCCTTTTTGTGCAAAGCT
    AATGATGATATATTTTTGACACTTTTTGCATTAATAAATGATAATGAGCAGCAACACATG
    AACTATAACATGGCATTAACAAGTAAATTTGCTAAAGATCGAATTATCAAATTGATATGC
    CATCTATGTCAGACAGTAGGATACGATCAAGATGAATTTTATGAAATCAAACAGTTTTTA
    ACTATTCAACTCATGAGTGATATGGCTGGGATTTCCCGGGAAACAGCTGGTCATATTATT
    CATGAACTTAAAGATGAAAAACTTGTTGTTAAAGATCATAAAAATTGGTTAGTAAGCAAA
    CATTTATTCAATGATGTATGTGTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    687

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2653 [new locus tag: SACOL_RS13895 ]
  • symbol: SACOL2653
  • description: Crp/FNR family transcriptional regulator
  • length: 228
  • theoretical pI: 6.16679
  • theoretical MW: 26710.5
  • GRAVY: -0.238596

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionsglobal nitrogen regulator NtcA (TIGR03697; HMM-score: 26.4)
  • TheSEED:  
    Amino Acids and DerivativesArginine; urea cycle, polyaminesArginine and Ornithine Degradation Transcriptional regulator ArcR essential for anaerobic expression of the ADI pathway, Crp/Fnr family 
    Arginine; urea cycle, polyaminesArginine Deiminase Pathway Transcriptional regulator ArcR essential for anaerobic expression of the ADI pathway, Crp/Fnr family 
  • PFAM:
    HTH (CL0123) HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 29.7)
    Cupin (CL0029) cNMP_binding; Cyclic nucleotide-binding domain (PF00027; HMM-score: 28.4)
    no clan definedCatalase-rel; Catalase-related immune-responsive (PF06628; HMM-score: 13.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.108
    • Ymax_pos: 11
    • Cmax: 0.109
    • Cmax_pos: 33
    • Smax: 0.173
    • Smax_pos: 35
    • Smean: 0.116
    • D: 0.111
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MGRNNKLEHELKALADYINIPYSILQPYQSECFVRHYTKGQVIYFSPQESSNIYFLIEGNIIREHYNQNGDVYRYFNKEQVLFPISNLFHPKEVNELCTALTDCTVLGLPRELMAFLCKANDDIFLTLFALINDNEQQHMNYNMALTSKFAKDRIIKLICHLCQTVGYDQDEFYEIKQFLTIQLMSDMAGISRETAGHIIHELKDEKLVVKDHKNWLVSKHLFNDVCV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: SACOL2035 (Rex*), SACOL2653 (ArcR*), ArgR
    Rex* (TF) important in Energy metabolism  RegPrecise    transcription unit transferred from N315 data RegPrecise
    ArcR* (TF) important in Arginine degradation  RegPrecise    transcription unit transferred from N315 data RegPrecise
    ArgR (TF) important in Arginine biosynthesis, Arginine degradation  RegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]