From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS08865 [old locus tag: SACOL1734 ]
  • pan locus tag?: SAUPAN004309000
  • symbol: SACOL_RS08865
  • pan gene symbol?: gapB
  • synonym:
  • product: aldehyde dehydrogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS08865 [old locus tag: SACOL1734 ]
  • symbol: SACOL_RS08865
  • product: aldehyde dehydrogenase
  • replicon: chromosome
  • strand: -
  • coordinates: 1765067..1766092
  • length: 1026
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1765067..1766092) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    ATGTCAACGAATATTGCAATTAATGGTATGGGTAGAATTGGAAGAATGGTATTACGTATT
    GCATTACAAAATAAAAATTTAAATGTAGTAGCGATAAATGCTAGTTATCCACCCGAAACA
    ATTGCACATTTAATCAATTACGATACGACACATGGAAAATATAATCTAAAAGTTGAACCG
    ATTGAAAATGGATTGCAAGTTGGAGATCATAAAATTAAATTGGTTGCTGATCGCAATCCT
    GAAAACTTGCCATGGAAAGAATTAGATATCGATATTGCTATAGATGCAACTGGTAAATTT
    AATCATGGTGATAAAGCCATCGCACATATTAAAGCAGGTGCCAAAAAAGTTTTGTTAACT
    GGTCCTTCAAAAGGTGGACATGTTCAAATGGTAGTTAAAGGCGTAAATGATAACCAATTA
    GATATAGAAGCATTTGACATTTTTAGTAATGCTTCATGTACTACTAATTGCATTGGTCCA
    GTTGCAAAAGTTTTAAATAATCAGTTTGGAATAGTTAATGGTTTAATGACTACTGTTCAC
    GCTATTACAAATGACCAAAAAAATATTGATAATCCACATAAAGATTTAAGACGTGCACGT
    TCATGTAATGAAAGCATTATTCCTACTTCTACTGGTGCGGCGAAAGCTTTAAAAGAAGTA
    TTACCAGAATTAGAAGGTAAATTACACGGCATGGCATTACGTGTACCAACAAAGAATGTA
    TCGCTCGTTGATTTAGTTGTTGATTTAGAAAAAGAAGTAACTGCAGAAGAAGTAAACCAA
    GCTTTTGAAAATGCAGGTTTAGAAGGTATCATAGAAGTCGAACATCAACCACTAGTGTCT
    GTTGATTTTAATACTAATCCAAATTCAGCTATTATTGATGCAAAATCAACAATGGTCATG
    TCAGGGAATAAAGTAAAAGTTATTGCTTGGTATGATAATGAATGGGGTTATTCAAATAGA
    GTTGTAGATGTTGCTGAGCAAATTGGAGCACTTTTGACATCAAAAGAAACTGTAAGTGCA
    AGTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1026

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS08865 [old locus tag: SACOL1734 ]
  • symbol: SACOL_RS08865
  • description: aldehyde dehydrogenase
  • length: 341
  • theoretical pI: 6.35212
  • theoretical MW: 36979
  • GRAVY: -0.1739

Function[edit source | edit]

  • reaction:
    EC 1.2.1.12?  ExPASy
    Glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)D-glyceraldehyde 3-phosphate + phosphate + NAD+ = 3-phospho-D-glyceroyl phosphate + NADH
  • TIGRFAM:
    MetabolismEnergy metabolismGlycolysis/gluconeogenesisglyceraldehyde-3-phosphate dehydrogenase, type I (TIGR01534; EC 1.2.1.-; HMM-score: 412.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridoxineerythrose-4-phosphate dehydrogenase (TIGR01532; EC 1.2.1.72; HMM-score: 317.7)
    glyceraldehyde-3-phosphate dehydrogenase, type II (TIGR01546; EC 1.2.1.59; HMM-score: 18.2)
    MetabolismAmino acid biosynthesisAspartate familyaspartate-semialdehyde dehydrogenase (TIGR01296; EC 1.2.1.11; HMM-score: 16.3)
  • TheSEED:
  • PFAM:
    GADPH_aa-bio_dh (CL0139) Gp_dh_C; Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain (PF02800; HMM-score: 217.2)
    NADP_Rossmann (CL0063) Gp_dh_N; Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain (PF00044; HMM-score: 121.3)
    DapB_N; Dihydrodipicolinate reductase, N-terminus (PF01113; HMM-score: 16)
    KOW (CL0107) Ribosomal_L14e; Ribosomal protein L14 (PF01929; HMM-score: 13.4)
    NADP_Rossmann (CL0063) 2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 12.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL_RS03080elongation factor Tu  [1] (data from MRSA252)
    SACOL_RS04840NADH dehydrogenase  [1] (data from MRSA252)
    SACOL_RS05640dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    SACOL_RS0650530S ribosomal protein S2  [1] (data from MRSA252)
    SACOL_RS08930pyruvate kinase  [1] (data from MRSA252)
    SACOL_RS08995universal stress protein UspA  [1] (data from MRSA252)
    SACOL_RS11230glutamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SACOL_RS1168550S ribosomal protein L15  [1] (data from MRSA252)
    SACOL_RS1175030S ribosomal protein S3  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.21
    • Ymax_pos: 34
    • Cmax: 0.13
    • Cmax_pos: 34
    • Smax: 0.481
    • Smax_pos: 27
    • Smean: 0.294
    • D: 0.243
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446028286 NCBI
  • RefSeq: WP_000106141 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MSTNIAINGMGRIGRMVLRIALQNKNLNVVAINASYPPETIAHLINYDTTHGKYNLKVEPIENGLQVGDHKIKLVADRNPENLPWKELDIDIAIDATGKFNHGDKAIAHIKAGAKKVLLTGPSKGGHVQMVVKGVNDNQLDIEAFDIFSNASCTTNCIGPVAKVLNNQFGIVNGLMTTVHAITNDQKNIDNPHKDLRRARSCNESIIPTSTGAAKALKEVLPELEGKLHGMALRVPTKNVSLVDLVVDLEKEVTAEEVNQAFENAGLEGIIEVEHQPLVSVDFNTNPNSAIIDAKSTMVMSGNKVKVIAWYDNEWGYSNRVVDVAEQIGALLTSKETVSAS

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS08865 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]