From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00505
  • pan locus tag?: SAUPAN002290000
  • symbol: SAOUHSC_00505
  • pan gene symbol?: clpC
  • synonym:
  • product: endopeptidase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00505
  • symbol: SAOUHSC_00505
  • product: endopeptidase
  • replicon: chromosome
  • strand: +
  • coordinates: 505226..507682
  • length: 2457
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    ATGTTATTTGGTAGATTAACTGAGCGTGCACAGCGCGTATTAGCACATGCCCAAGAAGAA
    GCAATTCGTTTAAATCATTCAAATATAGGAACAGAACACCTATTATTGGGGTTAATGAAA
    GAACCTGAAGGAATTGCTGCAAAAGTATTAGAAAGTTTTAATATCACTGAAGATAAAGTA
    ATTGAAGAAGTTGAAAAATTAATCGGACATGGTCAAGATCATGTTGGTACATTGCATTAT
    ACACCTAGAGCTAAAAAAGTCATTGAATTATCGATGGATGAAGCTAGAAAATTACATCAC
    AATTTTGTTGGAACGGAACATATTTTATTAGGCTTGATTCGTGAAAATGAAGGTGTTGCA
    GCAAGAGTTTTTGCAAATCTAGATTTAAATATTACTAAAGCACGTGCACAAGTTGTGAAA
    GCTTTAGGAAACCCTGAAATGAGTAATAAAAATGCACAAGCTAGTAAGTCAAATAATACT
    CCAACTTTAGATAGTTTAGCTCGTGACTTAACAGTCATTGCCAAAGACGGTACATTAGAT
    CCTGTTATAGGACGTGATAAAGAAATTACACGTGTAATTGAAGTATTAAGTAGACGTACG
    AAAAACAATCCTGTGCTTATTGGAGAGCCAGGTGTTGGTAAAACTGCTATTGCTGAAGGT
    TTAGCGCAAGCCATAGTGAATAATGAGGTACCAGAGACATTAAAAGATAAGCGTGTTATG
    TCTTTAGATATGGGAACAGTAGTTGCAGGTACTAAATATCGTGGTGAATTTGAAGAGCGT
    CTGAAAAAGGTTATGGAAGAAATCCAACAAGCAGGTAATGTCATCCTATTTATTGATGAG
    TTGCATACTTTAGTTGGTGCTGGTGGTGCTGAAGGTGCTATCGATGCTTCGAATATTTTG
    AAGCCGGCATTAGCACGTGGTGAATTACAATGTATTGGTGCTACTACATTAGATGAATAT
    CGCAAAAATATTGAAAAAGACGCGGCTTTAGAACGTCGTTTCCAACCTGTACAAGTTGAT
    GAACCTTCAGTAGTAGATACAGTTGCTATTTTAAAAGGATTAAGAGATCGTTACGAAGCA
    CACCATCGTATTAATATTTCAGACGAAGCTATTGAAGCAGCTGTTAAATTAAGTAACAGA
    TACGTTTCAGATCGTTTCTTACCAGATAAAGCAATTGATTTAATTGATGAAGCAAGTTCT
    AAAGTAAGACTTAAGAGTCATACGACACCTAATAATTTAAAAGAAATTGAACAAGAAATT
    GAAAAAGTTAAAAATGAAAAAGATGCCGCAGTACATGCTCAAGAGTTTGAAAATGCTGCT
    AACCTGCGTGATAAACAAACAAAACTTGAAAAGCAATATGAAGAAGCTAAAAATGAATGG
    AAGAATGCACAAAATGGCATGTCAACTTCATTGTCAGAAGAAGATATTGCTGAAGTTATT
    GCAGGATGGACAGGTATCCCATTAACTAAAATCAATGAAACAGAATCTGAAAAACTTCTT
    AGTCTAGAAGATACATTACATGAGAGAGTTATTGGGCAAAAAGATGCTGTTAATTCAATC
    AGTAAAGCGGTTAGACGTGCCCGTGCAGGGTTAAAAGATCCTAAACGACCAATTGGTAGC
    TTTATCTTCCTTGGACCAACTGGTGTTGGTAAAACTGAATTAGCTAGAGCTTTAGCTGAA
    TCAATGTTTGGCGATGATGATGCGATGATCCGTGTAGACATGAGTGAATTTATGGAAAAA
    CACGCAGTGAGCCGATTAGTTGGTGCTCCTCCAGGATATGTTGGTCATGATGATGGTGGA
    CAATTAACTGAAAAAGTTAGACGTAAACCATATTCTGTAATTTTATTTGATGAAATTGAA
    AAAGCTCATCCAGATGTATTTAATATTCTATTACAAGTTTTAGATGATGGACATTTGACA
    GATACAAAAGGACGTACAGTTGATTTCAGAAATACAATTATCATAATGACATCAAACGTT
    GGGGCACAAGAATTACAAGATCAACGATTTGCTGGATTCGGTGGTTCAAGTGATGGACAA
    GATTATGAAACAATTCGAAAAACGATGTTAAAAGAATTAAAAAATTCATTCCGTCCAGAA
    TTTTTAAACCGTGTAGATGATATCATTGTATTCCATAAACTAACAAAAGAAGAATTAAAA
    GAAATTGTAACAATGATGGTTAATAAATTAACAAATCGATTATCTGAACAAAACATAAAT
    ATTATTGTAACTGATAAAGCGAAAGACAAAATCGCAGAAGAAGGATATGATCCAGAATAT
    GGTGCAAGACCATTAATTAGAGCGATACAAAAAACTATCGAAGATAATTTAAGTGAATTA
    ATATTAGATGGTAATCAAATTGAAGGTAAGAAAGTTACAGTAGATCATGATGGTAAAGAG
    TTTAAATATGACATTGCTGAACAAACTTCAGAAACTAAAACACCATCGCAAGCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2457

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_00505
  • symbol: SAOUHSC_00505
  • description: endopeptidase
  • length: 818
  • theoretical pI: 5.4692
  • theoretical MW: 91036.7
  • GRAVY: -0.464548

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent chaperone protein ClpB (TIGR03346; HMM-score: 1067.9)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease ATP-binding subunit ClpA (TIGR02639; HMM-score: 820.3)
    Cellular processesCellular processesPathogenesistype VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 789.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 789.9)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 45)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 45)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 40.5)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesputative ATP-dependent protease (TIGR00764; HMM-score: 35.3)
    Cellular processesCellular processesSporulation and germinationstage V sporulation protein K (TIGR02881; HMM-score: 34.6)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent protease HslVU, ATPase subunit (TIGR00390; HMM-score: 30.9)
    AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 30.1)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairorc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 29.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 28.3)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 27.6)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 27.6)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesendopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 25.2)
    Cellular processesCellular processesChemotaxis and motilityflagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 24.8)
    Cellular processesCellular processesOthergas vesicle protein GvpN (TIGR02640; HMM-score: 24.5)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 21.5)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDnaA regulatory inactivator Hda (TIGR03420; HMM-score: 20.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, delta' subunit (TIGR00678; EC 2.7.7.7; HMM-score: 20.1)
    CbbX protein (TIGR02880; HMM-score: 16.9)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 11.3)
    Plasmodium falciparum uncharacterized domain TIGR01639 (TIGR01639; HMM-score: 11.1)
    Genetic information processingTranscriptionTranscription factorsRNA polymerase-binding protein DksA (TIGR02420; HMM-score: 7.6)
    Signal transductionRegulatory functionsSmall molecule interactionsRNA polymerase-binding protein DksA (TIGR02420; HMM-score: 7.6)
  • TheSEED:  
    Protein MetabolismProtein degradationProteolysis in bacteria, ATP-dependent ATP-dependent Clp protease, ATP-binding subunit ClpC 
  • PFAM:
    P-loop_NTPase (CL0023) AAA_2; AAA domain (Cdc48 subfamily) (PF07724; HMM-score: 201.3)
    no clan definedClp_N; Clp amino terminal domain, pathogenicity island component (PF02861; HMM-score: 117.5)
    ClpB_D2-small; C-terminal, D2-small domain, of ClpB protein (PF10431; HMM-score: 97.1)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 96.6)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 71.3)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 47.4)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 46.7)
    AAA_22; AAA domain (PF13401; HMM-score: 38.1)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 34)
    AAA_18; AAA domain (PF13238; HMM-score: 31)
    AAA_14; AAA domain (PF13173; HMM-score: 26.8)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 26.2)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 25.6)
    no clan definedUVR; UvrB/uvrC motif (PF02151; HMM-score: 24.6)
    P-loop_NTPase (CL0023) RNA_helicase; RNA helicase (PF00910; HMM-score: 24.2)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 23.5)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 23.3)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 23.3)
    NACHT; NACHT domain (PF05729; HMM-score: 22)
    AAA_3; ATPase family associated with various cellular activities (AAA) (PF07726; HMM-score: 21.3)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 21.1)
    AAA_33; AAA domain (PF13671; HMM-score: 20.8)
    AAA_28; AAA domain (PF13521; HMM-score: 20.2)
    Torsin; Torsin (PF06309; HMM-score: 19.9)
    DNA_pol3_delta2; DNA polymerase III, delta subunit (PF13177; HMM-score: 19.8)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 19.6)
    AAA_24; AAA domain (PF13479; HMM-score: 19.2)
    AAA_25; AAA domain (PF13481; HMM-score: 18.5)
    KTI12; Chromatin associated protein KTI12 (PF08433; HMM-score: 17.6)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 17.5)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 17.4)
    AAA_23; AAA domain (PF13476; HMM-score: 17)
    ABC_tran; ABC transporter (PF00005; HMM-score: 16.6)
    no clan definedDUF1002; Protein of unknown function (DUF1002) (PF06207; HMM-score: 16.4)
    P-loop_NTPase (CL0023) Ras; Ras family (PF00071; HMM-score: 16)
    Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 15.7)
    PhoH; PhoH-like protein (PF02562; HMM-score: 14.8)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 14.5)
    AAA_30; AAA domain (PF13604; HMM-score: 14.2)
    AAA_19; AAA domain (PF13245; HMM-score: 13.6)
    no clan definedDUF3783; Domain of unknown function (DUF3783) (PF12646; HMM-score: 12.8)
    P-loop_NTPase (CL0023) NTPase_1; NTPase (PF03266; HMM-score: 12.7)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 12.2)
    no clan definedABC_tran_CTD; ABC transporter C-terminal domain (PF16326; HMM-score: 11.4)
    P-loop_NTPase (CL0023) CbiA; CobQ/CobB/MinD/ParA nucleotide binding domain (PF01656; HMM-score: 10.9)
    no clan definedDUF4407; Domain of unknown function (DUF4407) (PF14362; HMM-score: 9.2)
    CHD5; CHD5-like protein (PF04420; HMM-score: 7.3)
    P-loop_NTPase (CL0023) DUF87; Domain of unknown function DUF87 (PF01935; HMM-score: 6.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SAOUHSC_00790(clpP)ATP-dependent Clp protease proteolytic subunit  [1] (data from MRSA252)
    SAOUHSC_01757(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SAOUHSC_02507(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SAOUHSC_02477(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SAOUHSC_00187formate acetyltransferase  [1] (data from MRSA252)
    SAOUHSC_00530elongation factor Tu  [1] (data from MRSA252)
    SAOUHSC_01040pyruvate dehydrogenase complex, E1 component subunit alpha  [1] (data from MRSA252)
    SAOUHSC_01041pyruvate dehydrogenase complex, E1 component subunit beta  [1] (data from MRSA252)
    SAOUHSC_01042branched-chain alpha-keto acid dehydrogenase subunit E2  [1] (data from MRSA252)
    SAOUHSC_01043dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SAOUHSC_01416dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SAOUHSC_01806pyruvate kinase  [1] (data from MRSA252)
    SAOUHSC_02223phi PVL orf 39-like protein  [1] (data from MRSA252)
    SAOUHSC_02441alkaline shock protein 23  [1] (data from MRSA252)
    SAOUHSC_02549molybdenum ABC transporter substrate-binding protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.95
    • Cytoplasmic Membrane Score: 0.05
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.179
    • Ymax_pos: 18
    • Cmax: 0.193
    • Cmax_pos: 18
    • Smax: 0.26
    • Smax_pos: 17
    • Smean: 0.154
    • D: 0.169
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MLFGRLTERAQRVLAHAQEEAIRLNHSNIGTEHLLLGLMKEPEGIAAKVLESFNITEDKVIEEVEKLIGHGQDHVGTLHYTPRAKKVIELSMDEARKLHHNFVGTEHILLGLIRENEGVAARVFANLDLNITKARAQVVKALGNPEMSNKNAQASKSNNTPTLDSLARDLTVIAKDGTLDPVIGRDKEITRVIEVLSRRTKNNPVLIGEPGVGKTAIAEGLAQAIVNNEVPETLKDKRVMSLDMGTVVAGTKYRGEFEERLKKVMEEIQQAGNVILFIDELHTLVGAGGAEGAIDASNILKPALARGELQCIGATTLDEYRKNIEKDAALERRFQPVQVDEPSVVDTVAILKGLRDRYEAHHRINISDEAIEAAVKLSNRYVSDRFLPDKAIDLIDEASSKVRLKSHTTPNNLKEIEQEIEKVKNEKDAAVHAQEFENAANLRDKQTKLEKQYEEAKNEWKNAQNGMSTSLSEEDIAEVIAGWTGIPLTKINETESEKLLSLEDTLHERVIGQKDAVNSISKAVRRARAGLKDPKRPIGSFIFLGPTGVGKTELARALAESMFGDDDAMIRVDMSEFMEKHAVSRLVGAPPGYVGHDDGGQLTEKVRRKPYSVILFDEIEKAHPDVFNILLQVLDDGHLTDTKGRTVDFRNTIIIMTSNVGAQELQDQRFAGFGGSSDGQDYETIRKTMLKELKNSFRPEFLNRVDDIIVFHKLTKEELKEIVTMMVNKLTNRLSEQNINIIVTDKAKDKIAEEGYDPEYGARPLIRAIQKTIEDNLSELILDGNQIEGKKVTVDHDGKEFKYDIAEQTSETKTPSQA

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  4. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]

Dorte Frees, Arnaud Chastanet, Saara Qazi, Karen Sørensen, Philip Hill, Tarek Msadek, Hanne Ingmer
Clp ATPases are required for stress tolerance, intracellular replication and biofilm formation in Staphylococcus aureus.
Mol. Microbiol.: 2004, 54(5);1445-62
[PubMed:15554981] [WorldCat.org] [DOI] (P p)