From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00507
  • pan locus tag?: SAUPAN002292000
  • symbol: SAOUHSC_00507
  • pan gene symbol?: radA
  • synonym:
  • product: DNA repair protein RadA

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00507
  • symbol: SAOUHSC_00507
  • product: DNA repair protein RadA
  • replicon: chromosome
  • strand: +
  • coordinates: 508167..509531
  • length: 1365
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    TTGGCCAAGAAAAAAGTGATTTTTGAATGTATGGCTTGTGGTTATCAATCTCCTAAATGG
    ATGGGGAAATGTCCTAATTGTGGCGCTTGGAATCAAATGGAGGAAATTGTTGAAAAAGCA
    GCCAATCCTAAACATGGAGTTAAAACCAAGGAATTAGCAGGTAAAGTACAAAAATTAAAT
    AGTATTAAACATGAAACAACGCCGAGAGTGTTAACAGATTCAGCAGAATTCAACCGTGTA
    TTAGGTGGAGGTATTGTGAGCGGATCGTTAGTACTTATTGGTGGGGATCCAGGTATTGGT
    AAGTCAACGTTACTTTTACAAATTTGTGCATCGTTATCTCAAAAGAAAAAAGTACTATAT
    ATTACTGGAGAAGAATCGCTTAGTCAGACTAAATTACGTGCAGAGCGATTAGATGAAGAT
    TCAAGTGAATTGCAAGTATTAGCTGAAACAGATCTTGAAGTTATTTATCAAACAGTAAAA
    GAAGAACAACCTGATTTATTAGTAGTGGATTCGATTCAAACAATATATCATCCTGAAATC
    AGCTCTGCGCCAGGTTCTGTTTCACAAGTTCGTGAAAGTACACAAAGTTTAATGAATATT
    GCTAAACAAATGAACATTGCAACTTTTATAGTGGGTCATGTAACGAAAGAAGGTCAAATT
    GCTGGCCCAAGATTGCTAGAACACATGGTTGATACTGTGCTTTATTTTGAAGGCGATGAA
    CACCACGCATATCGAATTTTGCGAGCTGTTAAAAACCGTTTTGGTTCAACGAATGAAATG
    GGAATCTTCGAAATGAAGCAAAGTGGATTAAAAGGTGTAAATAATCCATCTGAAATGTTT
    TTAGAAGAACGTTCAACAAATGTTCCAGGTTCAACAATTGTTGCAACCATGGAGGGAACC
    AGACCACTTTTAATAGAAGTTCAAGCGCTGGTAACTCCAACGACTTTTAACAATCCGAGA
    CGAATGGCAACAGGGATTGATCATAATCGATTAAGTTTGTTGATGGCTGTTTTGGAAAAG
    AAAGAAAATTATCTATTACAACAACAAGATGCTTATATCAAAGTAGCTGGCGGTGTAAAG
    TTAACGGAGCCAGCAGTTGATTTAAGTGTAATTGTAGCAACTGCATCTAGCTTTAAAGAT
    AAAGCTGTCGACGGATTAGATTGCTATATTGGAGAAGTTGGTTTAACGGGTGAGGTACGT
    CGTGTATCTCGGATAGAACAACGCGTGCAAGAGGCTGCAAAACTAGGTTTCAAACGTGTA
    ATTATTCCTAAAAATAATATAGGCGGATGGACATATCCTGAAGGTATACAAGTAATAGGT
    GTAACTACTGTACATGAAGTATTGTCATTTGCTCTTCATTCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1365

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_00507
  • symbol: SAOUHSC_00507
  • description: DNA repair protein RadA
  • length: 454
  • theoretical pI: 7.05095
  • theoretical MW: 49863.1
  • GRAVY: -0.169383

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA repair protein RadA (TIGR00416; HMM-score: 665.7)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 59.9)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 59.9)
    DNA repair and recombination protein RadB (TIGR02237; HMM-score: 51.9)
    KaiC domain protein, PAE1156 family (TIGR03881; HMM-score: 40.2)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesputative ATP-dependent protease (TIGR00764; HMM-score: 37.8)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 36.2)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 36.2)
    KaiC domain protein, Ph0284 family (TIGR03877; HMM-score: 30.4)
    Genetic information processingMobile and extrachromosomal element functionsProphage functionsphage replicative helicase, DnaB family (TIGR03600; HMM-score: 27.1)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairprotein RecA (TIGR02012; HMM-score: 25.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairreplicative DNA helicase (TIGR00665; EC 3.6.4.12; HMM-score: 24.8)
    KaiC domain protein, AF_0351 family (TIGR03880; HMM-score: 24.6)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesendopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 24.5)
    meiotic recombinase Dmc1 (TIGR02238; HMM-score: 21.8)
    Unknown functionGeneralMg chelatase-like protein (TIGR00368; HMM-score: 21)
    DNA repair protein RAD51 (TIGR02239; HMM-score: 20)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA repair and recombination protein RadA (TIGR02236; HMM-score: 19.9)
    Hypothetical proteinsConservedconserved hypothetical protein (TIGR02653; HMM-score: 16.8)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDnaA regulatory inactivator Hda (TIGR03420; HMM-score: 15.7)
    Cellular processesCellular processesOthercircadian clock protein KaiC (TIGR02655; EC 2.7.11.1; HMM-score: 13.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 13.8)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 13.8)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 13.4)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 13.4)
    MetabolismTransport and binding proteinsOtherpleiotropic drug resistance family protein (TIGR00956; HMM-score: 9.6)
  • TheSEED:  
    DNA MetabolismDNA repairDNA repair, bacterial DNA repair protein RadA 
  • PFAM:
    P-loop_NTPase (CL0023) AAA_25; AAA domain (PF13481; HMM-score: 58.2)
    ATPase; KaiC (PF06745; HMM-score: 55.7)
    Rad51; Rad51 (PF08423; HMM-score: 36.4)
    S5 (CL0329) ChlI; Subunit ChlI of Mg-chelatase (PF13541; HMM-score: 30.3)
    Lon_C; Lon protease (S16) C-terminal proteolytic domain (PF05362; HMM-score: 27.5)
    P-loop_NTPase (CL0023) DnaB_C; DnaB-like helicase C terminal domain (PF03796; HMM-score: 26.7)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 26.3)
    RecA; recA bacterial DNA recombination protein (PF00154; HMM-score: 24)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 23.3)
    AAA_24; AAA domain (PF13479; HMM-score: 23.1)
    AAA_22; AAA domain (PF13401; HMM-score: 22.6)
    AAA_14; AAA domain (PF13173; HMM-score: 22.2)
    ABC_tran; ABC transporter (PF00005; HMM-score: 20.9)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 20)
    NACHT; NACHT domain (PF05729; HMM-score: 17.9)
    NTPase_1; NTPase (PF03266; HMM-score: 17)
    CbiA; CobQ/CobB/MinD/ParA nucleotide binding domain (PF01656; HMM-score: 17)
    AAA_19; AAA domain (PF13245; HMM-score: 16.4)
    DUF2075; Uncharacterized conserved protein (DUF2075) (PF09848; HMM-score: 15.7)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 15.2)
    MCM; MCM2/3/5 family (PF00493; HMM-score: 14.1)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 14.1)
    GvpD; GvpD gas vesicle protein (PF07088; HMM-score: 13.9)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 13.7)
    AAA_30; AAA domain (PF13604; HMM-score: 13.7)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 13.4)
    KTI12; Chromatin associated protein KTI12 (PF08433; HMM-score: 13.3)
    AAA_23; AAA domain (PF13476; HMM-score: 13.1)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 13)
    DAP3; Mitochondrial ribosomal death-associated protein 3 (PF10236; HMM-score: 12.3)
    Zn_Beta_Ribbon (CL0167) RNA_POL_M_15KD; RNA polymerases M/15 Kd subunit (PF02150; HMM-score: 10.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.205
    • Ymax_pos: 23
    • Cmax: 0.154
    • Cmax_pos: 29
    • Smax: 0.479
    • Smax_pos: 14
    • Smean: 0.338
    • D: 0.257
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MAKKKVIFECMACGYQSPKWMGKCPNCGAWNQMEEIVEKAANPKHGVKTKELAGKVQKLNSIKHETTPRVLTDSAEFNRVLGGGIVSGSLVLIGGDPGIGKSTLLLQICASLSQKKKVLYITGEESLSQTKLRAERLDEDSSELQVLAETDLEVIYQTVKEEQPDLLVVDSIQTIYHPEISSAPGSVSQVRESTQSLMNIAKQMNIATFIVGHVTKEGQIAGPRLLEHMVDTVLYFEGDEHHAYRILRAVKNRFGSTNEMGIFEMKQSGLKGVNNPSEMFLEERSTNVPGSTIVATMEGTRPLLIEVQALVTPTTFNNPRRMATGIDHNRLSLLMAVLEKKENYLLQQQDAYIKVAGGVKLTEPAVDLSVIVATASSFKDKAVDGLDCYIGEVGLTGEVRRVSRIEQRVQEAAKLGFKRVIIPKNNIGGWTYPEGIQVIGVTTVHEVLSFALHS

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]