From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00714
  • pan locus tag?: SAUPAN002590000
  • symbol: SAOUHSC_00714
  • pan gene symbol?: saeS
  • synonym:
  • product: sensor histidine kinase SaeS

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00714
  • symbol: SAOUHSC_00714
  • product: sensor histidine kinase SaeS
  • replicon: chromosome
  • strand: -
  • coordinates: 699194..700249
  • length: 1056
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    ATGGTGTTATCAATTAGAAGTCAAATCATTATTGGCGTCGTATCGAGTATACTATTAACT
    TCAACTATTTTAGCAATTGCATATATTTTAATGTGGTTTAACGGCCATATGACACTAACT
    TTGACCTTAACGACAATAATTACAAGCTGTTTAACCTTATTAATATGTAGTATTTTTATT
    AATCCACTTATACAAAAAATTAAGCAGTTTAATATAAAAACTAAGCAATTTGCTAACGGA
    AATTACGCAAGCAATGATAAAACGTTTAATTCACCAAAAGAAATTTATGAATTAAATCAA
    TCTTTTAATAAAATGGCTTCTGAAATTACGCAACAAATGAATCAAATTAAATCCGAACAA
    CAAGAAAAAACAGAACTGATTCAAAACTTAGCCCATGATTTAAAAACACCTTTAGCAAGC
    ATTATTTCATATTCTGAAGGACTACGTGATGGTATAATCACTAAGGATCATGAGATTAAA
    GAGTCATACGACATATTAATTAAACAAGCAAACAGATTATCAACATTATTTGATGATATG
    ACTCATATTATCACTTTAAATACAGGTAAAACATATCCCCCAGAATTAATACAACTAGAC
    CAATTACTTGTATCAATATTGCAACCATATGAGCAACGTATCAAACATGAAAACCGCACA
    TTAGAAGTGAATTTCTGTAACGAAATTGATGCATTTTATCAATATCGAACGCCACTTGAG
    CGTATTTTAACAAACTTACTTGATAATGCGCTAAAATTTTCAAATGTTGGTAGTCGCATT
    GATATTAATATTAGTGAAAACGAAGATCAAGATACTATCGACATTGCTATTAGCGATGAA
    GGTATTGGCATTATACCAGAACTACAAGAACGTATATTCGAACGTACATTCAGAGTAGAA
    AACTCTCGTAATACAAAAACGGGTGGTTCTGGATTAGGCTTATATATAGCTAATGAACTC
    GCGCAACAAAATAACGCAAAAATCAGTGTAAGCAGTGATATAGATGTAGGAACTACGATG
    ACTGTAACATTACACAAATTAGACATTACGTCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1056

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_00714
  • symbol: SAOUHSC_00714
  • description: sensor histidine kinase SaeS
  • length: 351
  • theoretical pI: 4.97145
  • theoretical MW: 39741.2
  • GRAVY: -0.132764

Function[edit source | edit]

  • reaction:
    EC 2.7.13.3?  ExPASy
    Histidine kinaseATP + protein L-histidine = ADP + protein N-phospho-L-histidine
  • TIGRFAM:
    Signal transductionSignal transductionTwo-component systemsphosphate regulon sensor kinase PhoR (TIGR02966; EC 2.7.3.-; HMM-score: 140.7)
    heavy metal sensor kinase (TIGR01386; EC 2.7.13.3; HMM-score: 106.6)
    Signal transductionSignal transductionTwo-component systemsTMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 85.9)
    proteobacterial dedicated sortase system histidine kinase (TIGR03785; HMM-score: 64)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingputative PEP-CTERM system histidine kinase (TIGR02916; EC 2.7.13.3; HMM-score: 50.6)
    Signal transductionSignal transductionTwo-component systemsputative PEP-CTERM system histidine kinase (TIGR02916; EC 2.7.13.3; HMM-score: 50.6)
    MetabolismCentral intermediary metabolismNitrogen fixationnitrogen fixation negative regulator NifL (TIGR02938; HMM-score: 33.1)
    Signal transductionRegulatory functionsProtein interactionsnitrogen fixation negative regulator NifL (TIGR02938; HMM-score: 33.1)
  • TheSEED:  
    Two component system histidine kinase (EC 2.7.3.-) 
  • PFAM:
    His_Kinase_A (CL0025) HATPase_c; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (PF02518; HMM-score: 78.3)
    HisKA; His Kinase A (phospho-acceptor) domain (PF00512; HMM-score: 46.3)
    HATPase_c_3; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (PF13589; HMM-score: 20.3)
    HATPase_c_5; GHKL domain (PF14501; HMM-score: 19.6)
    no clan definedHAMP; HAMP domain (PF00672; HMM-score: 18.5)
    HIN; HIN-200/IF120x domain (PF02760; HMM-score: 17.8)
    DUF2969; Protein of unknown function (DUF2969) (PF11184; HMM-score: 15.2)
    Kinetocho_Slk19; Central kinetochore-associated (PF12709; HMM-score: 14.4)
    EI24; Etoposide-induced protein 2.4 (EI24) (PF07264; HMM-score: 14.2)
    DUF3290; Protein of unknown function (DUF3290) (PF11694; HMM-score: 13.5)
    Peptidase_M48_N; CAAX prenyl protease N-terminal, five membrane helices (PF16491; HMM-score: 13.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.17
    • Cytoplasmic Membrane Score: 9.51
    • Cellwall Score: 0.16
    • Extracellular Score: 0.15
    • Internal Helices: 2
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: 0
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.198
    • Ymax_pos: 13
    • Cmax: 0.228
    • Cmax_pos: 28
    • Smax: 0.525
    • Smax_pos: 7
    • Smean: 0.393
    • D: 0.274
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MVLSIRSQIIIGVVSSILLTSTILAIAYILMWFNGHMTLTLTLTTIITSCLTLLICSIFINPLIQKIKQFNIKTKQFANGNYASNDKTFNSPKEIYELNQSFNKMASEITQQMNQIKSEQQEKTELIQNLAHDLKTPLASIISYSEGLRDGIITKDHEIKESYDILIKQANRLSTLFDDMTHIITLNTGKTYPPELIQLDQLLVSILQPYEQRIKHENRTLEVNFCNEIDAFYQYRTPLERILTNLLDNALKFSNVGSRIDINISENEDQDTIDIAISDEGIGIIPELQERIFERTFRVENSRNTKTGGSGLGLYIANELAQQNNAKISVSSDIDVGTTMTVTLHKLDITS

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SAOUHSC_00715 (SaeR*)
    SaeR* (TF) important in Virulence

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]

A T Giraudo, A Calzolari, A A Cataldi, C Bogni, R Nagel
The sae locus of Staphylococcus aureus encodes a two-component regulatory system.
FEMS Microbiol. Lett.: 1999, 177(1);15-22
[PubMed:10436918] [WorldCat.org] (P p)
C Goerke, U Fluckiger, A Steinhuber, W Zimmerli, C Wolz
Impact of the regulatory loci agr, sarA and sae of Staphylococcus aureus on the induction of alpha-toxin during device-related infection resolved by direct quantitative transcript analysis.
Mol. Microbiol.: 2001, 40(6);1439-47
[PubMed:11442841] [WorldCat.org] (P p)
Ana T Giraudo, Cecilia Mansilla, Ana Chan, Claudia Raspanti, Rosa Nagel
Studies on the expression of regulatory locus sae in Staphylococcus aureus.
Curr. Microbiol.: 2003, 46(4);246-50
[PubMed:12732971] [WorldCat.org] [DOI] (P p)
Richard P Novick, Dunrong Jiang
The staphylococcal saeRS system coordinates environmental signals with agr quorum sensing.
Microbiology (Reading, Engl.): 2003, 149(Pt 10);2709-17
[PubMed:14523104] [WorldCat.org] [DOI] (P p)
Andrea Steinhuber, Christiane Goerke, Manfred G Bayer, Gerd Döring, Christiane Wolz
Molecular architecture of the regulatory Locus sae of Staphylococcus aureus and its impact on expression of virulence factors.
J. Bacteriol.: 2003, 185(21);6278-86
[PubMed:14563862] [WorldCat.org] (P p)
Bret M Benton, J P Zhang, Skip Bond, Casey Pope, Todd Christian, Lawrence Lee, Kelly M Winterberg, Molly B Schmid, Jerry M Buysse
Large-scale identification of genes required for full virulence of Staphylococcus aureus.
J. Bacteriol.: 2004, 186(24);8478-89
[PubMed:15576798] [WorldCat.org] [DOI] (P p)
Niamh Harraghy, Jan Kormanec, Christiane Wolz, Dagmar Homerova, Christiane Goerke, Knut Ohlsen, Saara Qazi, Philip Hill, Mathias Herrmann
sae is essential for expression of the staphylococcal adhesins Eap and Emp.
Microbiology (Reading, Engl.): 2005, 151(Pt 6);1789-800
[PubMed:15941988] [WorldCat.org] [DOI] (P p)
Yan Q Xiong, Julie Willard, Michael R Yeaman, Ambrose L Cheung, Arnold S Bayer
Regulation of Staphylococcus aureus alpha-toxin gene (hla) expression by agr, sarA, and sae in vitro and in experimental infective endocarditis.
J. Infect. Dis.: 2006, 194(9);1267-75
[PubMed:17041853] [WorldCat.org] [DOI] (P p)
A T Giraudo, C G Raspanti, A Calzolari, R Nagel
Characterization of a Tn551-mutant of Staphylococcus aureus defective in the production of several exoproteins.
Can. J. Microbiol.: 1994, 40(8);677-81
[PubMed:7922890] [WorldCat.org] (P p)
A T Giraudo, H Rampone, A Calzolari, R Nagel
Phenotypic characterization and virulence of a sae- agr- mutant of Staphylococcus aureus.
Can. J. Microbiol.: 1996, 42(2);120-3
[PubMed:8742355] [WorldCat.org] (P p)
A T Giraudo, A L Cheung, R Nagel
The sae locus of Staphylococcus aureus controls exoprotein synthesis at the transcriptional level.
Arch. Microbiol.: 1997, 168(1);53-8
[PubMed:9211714] [WorldCat.org] (P p)