From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00988
  • pan locus tag?: SAUPAN003251000
  • symbol: SAOUHSC_00988
  • pan gene symbol?: sspA
  • synonym:
  • product: glutamyl endopeptidase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00988
  • symbol: SAOUHSC_00988
  • product: glutamyl endopeptidase
  • replicon: chromosome
  • strand: -
  • coordinates: 959416..960426
  • length: 1011
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGAAAGGTAAATTTTTAAAAGTTAGTTCTTTATTCGTTGCAACTTTGACAACAGCGACA
    CTTGTGAGTTCTCCAGCAGCAAACGCGTTATCTTCAAAGGCTATGGACAATCATCCACAA
    CAAACGCAGTCAAGCAAACAGCAAACACCTAAGATTCAAAAAGGCGGTAACCTTAAACCA
    TTAGAACAACGTGAACACGCAAATGTTATATTACCAAATAACGATCGTCACCAAATCACA
    GATACAACGAATGGTCATTATGCACCCGTAACTTATATTCAAGTTGAAGCACCTACTGGT
    ACATTTATTGCTTCCGGTGTAGTTGTAGGTAAAGATACTCTTTTAACAAATAAACACGTC
    GTAGATGCTACGCACGGTGATCCTCATGCTTTAAAAGCATTCCCTTCTGCAATTAACCAA
    GACAATTATCCAAATGGTGGTTTCACTGCTGAACAAATCACTAAATATTCAGGCGAAGGT
    GATTTAGCAATAGTTAAATTCTCCCCTAATGAGCAAAACAAACATATTGGTGAAGTAGTT
    AAACCAGCAACAATGAGTAATAATGCTGAAACACAAGTTAACCAAAATATTACTGTAACA
    GGATATCCTGGTGATAAACCTGTAGCAACAATGTGGGAAAGTAAAGGAAAAATCACTTAC
    CTCAAAGGCGAAGCTATGCAATATGATTTAAGTACAACTGGTGGTAATTCAGGTTCACCT
    GTATTTAATGAAAAAAATGAAGTGATCGGAATTCATTGGGGCGGTGTACCAAATGAATTT
    AATGGTGCGGTATTTATTAATGAAAATGTACGCAACTTCTTAAAACAAAATATTGAAGAT
    ATCCATTTTGCCAACGATGACCAACCTAATAACCCAGATAATCCTGATAACCCTAACAAT
    CCTGATAACCCTAACAACCCAGATGAACCAAATAACCCTGACAACCCTAACAACCCTGAT
    AATCCAGACAATGGCGATAACAATAATTCAGACAATCCAGATGCAGCTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1011

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_00988
  • symbol: SAOUHSC_00988
  • description: glutamyl endopeptidase
  • length: 336
  • theoretical pI: 4.80889
  • theoretical MW: 36325.4
  • GRAVY: -0.839881

Function[edit source | edit]

  • reaction:
    EC 3.4.21.19?  ExPASy
    Glutamyl endopeptidasePreferential cleavage: Glu-|-Xaa, Asp-|-Xaa
  • TIGRFAM:
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidespeptidase Do (TIGR02037; EC 3.4.21.-; HMM-score: 18.1)
    Genetic information processingProtein fateProtein folding and stabilizationpeptidase Do (TIGR02037; EC 3.4.21.-; HMM-score: 18.1)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesperiplasmic serine peptidase DegS (TIGR02038; EC 3.4.21.-; HMM-score: 13.3)
    Signal transductionRegulatory functionsProtein interactionsperiplasmic serine peptidase DegS (TIGR02038; EC 3.4.21.-; HMM-score: 13.3)
  • TheSEED:  
    Protein MetabolismProtein degradationEC 3.4.21.- Serine endopeptidase Glutamyl endopeptidase precursor (EC 3.4.21.19), serine proteinase SspA 
  • PFAM:
    Peptidase_PA (CL0124) Trypsin_2; Trypsin-like peptidase domain (PF13365; HMM-score: 75.1)
    Trypsin; Trypsin (PF00089; HMM-score: 50.2)
    Peptidase_S46; Peptidase S46 (PF10459; HMM-score: 26.9)
    Peptidase_S7; Peptidase S7, Flavivirus NS3 serine protease (PF00949; HMM-score: 22.2)
    Peptidase_C3; 3C cysteine protease (picornain 3C) (PF00548; HMM-score: 18.4)
    Peptidase_S32; Equine arteritis virus serine endopeptidase S32 (PF05579; HMM-score: 17.2)
    Peptidase_S39; Peptidase S39 (PF02122; HMM-score: 16.1)
    Peptidase_CA (CL0125) Phytochelatin; Phytochelatin synthase (PF05023; HMM-score: 11.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0
    • Extracellular Score: 10
    • Internal Helices: 0
  • LocateP: Secretory(released) (with CS)
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: -0.17
    • Signal Peptide Possibility: 1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: VSSPAANA
  • SignalP: Signal peptide length 30 aa
    • Ymax: 0.552
    • Ymax_pos: 30
    • Cmax: 0.329
    • Cmax_pos: 30
    • Smax: 0.982
    • Smax_pos: 13
    • Smean: 0.944
    • D: 0.705
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKGKFLKVSSLFVATLTTATLVSSPAANALSSKAMDNHPQQTQSSKQQTPKIQKGGNLKPLEQREHANVILPNNDRHQITDTTNGHYAPVTYIQVEAPTGTFIASGVVVGKDTLLTNKHVVDATHGDPHALKAFPSAINQDNYPNGGFTAEQITKYSGEGDLAIVKFSPNEQNKHIGEVVKPATMSNNAETQVNQNITVTGYPGDKPVATMWESKGKITYLKGEAMQYDLSTTGGNSGSPVFNEKNEVIGIHWGGVPNEFNGAVFINENVRNFLKQNIEDIHFANDDQPNNPDNPDNPNNPDNPNNPDEPNNPDNPNNPDNPDNGDNNNSDNPDAA

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]

J A Lindsay, S J Foster
Interactive regulatory pathways control virulence determinant production and stability in response to environmental conditions in Staphylococcus aureus.
Mol. Gen. Genet.: 1999, 262(2);323-31
[PubMed:10517329] [WorldCat.org] (P p)
K Rice, R Peralta, D Bast, J de Azavedo, M J McGavin
Description of staphylococcus serine protease (ssp) operon in Staphylococcus aureus and nonpolar inactivation of sspA-encoded serine protease.
Infect. Immun.: 2001, 69(1);159-69
[PubMed:11119502] [WorldCat.org] [DOI] (P p)
A Karlsson, P Saravia-Otten, K Tegmark, E Morfeldt, S Arvidson
Decreased amounts of cell wall-associated protein A and fibronectin-binding proteins in Staphylococcus aureus sarA mutants due to up-regulation of extracellular proteases.
Infect. Immun.: 2001, 69(8);4742-8
[PubMed:11447146] [WorldCat.org] [DOI] (P p)
Anna Karlsson, Staffan Arvidson
Variation in extracellular protease production among clinical isolates of Staphylococcus aureus due to different levels of expression of the protease repressor sarA.
Infect. Immun.: 2002, 70(8);4239-46
[PubMed:12117932] [WorldCat.org] (P p)
Isabella Massimi, Ellen Park, Kelly Rice, Werner Muller-Esterl, Daniel Sauder, Martin J McGavin
Identification of a novel maturation mechanism and restricted substrate specificity for the SspB cysteine protease of Staphylococcus aureus.
J. Biol. Chem.: 2002, 277(44);41770-7
[PubMed:12207024] [WorldCat.org] [DOI] (P p)
Lindsey Shaw, Ewa Golonka, Jan Potempa, Simon J Foster
The role and regulation of the extracellular proteases of Staphylococcus aureus.
Microbiology (Reading, Engl.): 2004, 150(Pt 1);217-28
[PubMed:14702415] [WorldCat.org] (P p)