From AureoWiki
Jump to: navigation, search

NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01081
  • pan locus tag?: SAUPAN003359000
  • symbol: SAOUHSC_01081
  • pan gene symbol?: isdA
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_01081
  • symbol: SAOUHSC_01081
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1044368..1045420
  • length: 1053
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    ATGACAAAACATTATTTAAACAGTAAGTATCAATCAGAACAACGTTCATCAGCTATGAAA
    AAGATTACAATGGGTACAGCATCTATCATTTTAGGTTCCCTTGTATACATAGGCGCAGAC
    AGCCAACAAGTCAATGCGGCAACAGAAGCTACGAACGCAACTAATAATCAAAGCACACAA
    GTTTCTCAAGCAACATCACAACCAATTAATTTCCAAGTGCAAAAAGATGGCTCTTCAGAG
    AAGTCACACATGGATGACTATATGCAACACCCTGGTAAAGTAATTAAACAAAATAATAAA
    TATTATTTCCAAACCGTGTTAAACAATGCATCATTCTGGAAAGAATACAAATTTTACAAT
    GCAAACAATCAAGAATTAGCAACAACTGTTGTTAACGATAATAAAAAAGCGGATACTAGA
    ACAATCAATGTTGCAGTTGAACCTGGATATAAGAGCTTAACTACTAAAGTACATATTGTC
    GTGCCACAAATTAATTACAATCATAGATATACTACGCATTTGGAATTTGAAAAAGCAATT
    CCTACATTAGCTGACGCAGCAAAACCAAACAATGTTAAACCGGTTCAACCAAAACCAGCT
    CAACCTAAAACACCTACTGAGCAAACTAAACCAGTTCAACCTAAAGTTGAAAAAGTTAAA
    CCTACTGTAACTACAACAAGCAAAGTTGAAGACAATCACTCTACTAAAGTTGTAAGTACT
    GACACAACAAAAGATCAAACTAAAACACAAACTGCTCATACAGTTAAAACAGCACAAACT
    GCTCAAGAACAAAATAAAGTTCAAACACCTGTTAAAGATGTTGCAACAGCGAAATCTGAA
    AGCAACAATCAAGCTGTAAGTGATAATAAATCACAACAAACTAACAAAGTTACAAAACAT
    AACGAAACGCCTAAACAAGCATCTAAAGCTAAAGAATTACCAAAAACTGGTTTAACTTCA
    GTTGATAACTTTATTAGCACAGTTGCCTTCGCAACACTTGCCCTTTTAGGTTCATTATCT
    TTATTACTTTTCAAAAGAAAAGAATCTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1053

Protein[edit source | edit]

Protein Data Bank: 3QZL
Protein Data Bank: 3QZM
Protein Data Bank: 3QZN
Protein Data Bank: 3QZO
Protein Data Bank: 3QZP
Protein Data Bank: 2ITE
Protein Data Bank: 2ITF

General[edit source | edit]

  • locus tag: SAOUHSC_01081
  • symbol: SAOUHSC_01081
  • description: hypothetical protein
  • length: 350
  • theoretical pI: 10.2642
  • theoretical MW: 38745.2
  • GRAVY: -0.817714

Function[edit source | edit]

  • TIGRFAM:
    heme uptake protein IsdC (TIGR03656; HMM-score: 60.1)
    and 3 more
    Cell structureCell envelopeOtherLPXTG cell wall anchor domain (TIGR01167; HMM-score: 22.5)
    gram-positive signal peptide, YSIRK family (TIGR01168; HMM-score: 16)
    pullulanase, extracellular (TIGR02102; HMM-score: 9.8)
  • TheSEED:  
    Cell Wall and CapsuleGram-Positive cell wall componentsSortase Cell surface protein IsdA, transfers heme from hemoglobin to apo-IsdC 
    and 1 more
    Iron acquisition and metabolismIron acquisition and metabolism - no subcategoryHeme, hemin uptake and utilization systems in GramPositives Cell surface protein IsdA, transfers heme from hemoglobin to apo-IsdC 
  • PFAM:
    no clan definedNEAT; Iron Transport-associated domain (PF05031; HMM-score: 87.5)
    and 4 more
    Gram_pos_anchor; LPXTG cell wall anchor motif (PF00746; HMM-score: 37.1)
    DUF5044; Domain of unknown function (DUF5044) (PF16447; HMM-score: 15.3)
    YjbE; Exopolysaccharide production protein YjbE (PF11106; HMM-score: 13)
    post-AAA (CL0604) MgsA_C; MgsA AAA+ ATPase C terminal (PF12002; HMM-score: 6.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cellwall
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 10
    • Extracellular Score: 0
    • Internal Helices: 2
  • LocateP: LPxTG Cell-wall anchored
    • Prediction by SwissProt Classification: Cell Wall
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0
    • Signal Peptide Possibility: 0
    • N-terminally Anchored Score: -2
    • Predicted Cleavage Site: found LPxTG motif :LPKTG
  • SignalP: Signal peptide length 47 aa
    • Ymax: 0.618
    • Ymax_pos: 47
    • Cmax: 0.504
    • Cmax_pos: 47
    • Smax: 0.843
    • Smax_pos: 37
    • Smean: 0.598
    • D: 0.61
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTKHYLNSKYQSEQRSSAMKKITMGTASIILGSLVYIGADSQQVNAATEATNATNNQSTQVSQATSQPINFQVQKDGSSEKSHMDDYMQHPGKVIKQNNKYYFQTVLNNASFWKEYKFYNANNQELATTVVNDNKKADTRTINVAVEPGYKSLTTKVHIVVPQINYNHRYTTHLEFEKAIPTLADAAKPNNVKPVQPKPAQPKTPTEQTKPVQPKVEKVKPTVTTTSKVEDNHSTKVVSTDTTKDQTKTQTAHTVKTAQTAQEQNKVQTPVKDVATAKSESNNQAVSDNKSQQTNKVTKHNETPKQASKAKELPKTGLTSVDNFISTVAFATLALLGSLSLLLFKRKESK

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]

John M Taylor, David E Heinrichs
Transferrin binding in Staphylococcus aureus: involvement of a cell wall-anchored protein.
Mol. Microbiol.: 2002, 43(6);1603-14
[PubMed:11952908] [WorldCat.org] (P p)
Julie A Morrissey, Alan Cockayne, Jane Hammacott, Keith Bishop, Amy Denman-Johnson, Philip J Hill, Paul Williams
Conservation, surface exposure, and in vivo expression of the Frp family of iron-regulated cell wall proteins in Staphylococcus aureus.
Infect. Immun.: 2002, 70(5);2399-407
[PubMed:11953376] [WorldCat.org] (P p)
Simon R Clarke, Michael D Wiltshire, Simon J Foster
IsdA of Staphylococcus aureus is a broad spectrum, iron-regulated adhesin.
Mol. Microbiol.: 2004, 51(5);1509-19
[PubMed:14982642] [WorldCat.org] [DOI] (P p)
Christie L Vermeiren, Mark Pluym, John Mack, David E Heinrichs, Martin J Stillman
Characterization of the heme binding properties of Staphylococcus aureus IsdA.
Biochemistry: 2006, 45(42);12867-75
[PubMed:17042505] [WorldCat.org] [DOI] (P p)
Jason C Grigg, Christie L Vermeiren, David E Heinrichs, Michael E P Murphy
Haem recognition by a Staphylococcus aureus NEAT domain.
Mol. Microbiol.: 2007, 63(1);139-49
[PubMed:17229211] [WorldCat.org] [DOI] (P p)
Mark Pluym, Naomi Muryoi, David E Heinrichs, Martin J Stillman
Heme binding in the NEAT domains of IsdA and IsdC of Staphylococcus aureus.
J. Inorg. Biochem.: 2008, 102(3);480-8
[PubMed:18194816] [WorldCat.org] [DOI] (P p)