From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01278
  • pan locus tag?: SAUPAN003613000
  • symbol: SAOUHSC_01278
  • pan gene symbol?: glpD
  • synonym:
  • product: aerobic glycerol-3-phosphate dehydrogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_01278
  • symbol: SAOUHSC_01278
  • product: aerobic glycerol-3-phosphate dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 1234935..1236608
  • length: 1674
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    ATGGCATTGTCTACTTTTAAGAGAGAACATATTAAAAAGAATTTAAGAAATGATGAATAT
    GATTTAGTAATTATTGGTGGCGGTATTACAGGTGCAGGTATTGCACTAGACGCGAGTGAA
    AGAGGAATGAAAGTTGCATTAGTTGAAATGCAAGACTTTGCACAAGGAACAAGCTCAAGA
    TCTACAAAATTAGTCCATGGTGGTTTGCGTTACTTAAAACAATTCCAAATTGGAGTAGTT
    GCCGAAACTGGTAAAGAACGTGCGATTGTTTATGAAAATGGGCCTCATGTTACGACTCCA
    GAGTGGATGCTTTTACCAATGCATAAAGGTGGAACATTTGGTAAATTCTCAACATCAATT
    GGTTTAGGAATGTATGATCGTTTAGCAGGTGTTAAGAAGTCTGAACGTAAAAAAATGTTA
    TCTAAAAAAGAAACTTTAGCTAAAGAACCATTAGTTAAAAAAGAAGGTCTAAAAGGCGGC
    GGTTACTATGTTGAATATCGTACTGACGATGCGCGTTTAACTATTGAAGTTATGAAGCGT
    GCTGCTGAAAAAGGCGCAGAAATTATCAACTATACTAAATCTGAACACTTCACTTATGAT
    AAAAATCAACAAGTAAATGGTGTTAAAGTTATAGATAAATTAACTAATGAAAATTATACA
    ATTAAGGCTAAAAAAGTGGTTAATGCAGCAGGTCCATGGGTTGATGATGTTAGAAGTGGT
    GATTATGCACGCAATAATAAAAAATTACGTTTAACTAAAGGTGTACATGTTGTTATTGAT
    CAATCAAAATTCCCATTAGGTCAAGCAGTATACTTTGATACTGAAAAAGATGGAAGAATG
    ATTTTTGCAATTCCACGTGAAGGAAAAGCGTATGTAGGTACTACAGATACATTCTATGAC
    AATATCAAATCTTCACCATTAACTACACAAGAAGACAGAGACTATTTAATCGATGCGATT
    AATTACATGTTCCCTAGTGTTAATGTTACAGATGAAGATATTGAATCAACATGGGCAGGA
    ATTAGACCATTAATTTACGAAGAAGGCAAAGACCCTTCTGAAATCTCTCGTAAGGATGAA
    ATTTGGGAAGGTAAATCAGGTTTATTAACTATTGCAGGTGGTAAATTAACAGGCTATCGT
    CACATGGCTCAAGACATTGTTGATTTAGTATCTAAACGCTTGAAAAAAGACTACGGTTTA
    ACATTTAGTCCATGTAATACAAAAGGTCTGGCAATTTCAGGTGGCGATGTAGGTGGTAGC
    AAGAACTTTGATGCGTTTGTAGAGCAAAAAGTAGATGTAGCTAAAGGATTCGGCATTGAT
    GAAGATGTTGCAAGACGTTTAGCATCTAAATATGGTTCAAATGTTGATGAATTGTTCAAC
    ATTGCGCAAACATCTCAATACCATGATAGCAAGTTACCATTAGAAATTTATGTAGAACTT
    GTTTATAGTATTCAACAAGAAATGGTATACAAACCTAACGATTTCTTAGTTCGTCGTTCT
    GGTAAAATGTATTTCAATATTAAAGATGTATTAGATTATAAAGATGCTGTCATCGATATT
    ATGGCAGATATGCTTGATTACTCTCCAGCTCAAATTGAAGCATATACTGAAGAAGTTGAG
    CAAGCAATTAAAGAAGCGCAACATGGAAATAATCAACCAGCAGTTAAAGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1674

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_01278
  • symbol: SAOUHSC_01278
  • description: aerobic glycerol-3-phosphate dehydrogenase
  • length: 557
  • theoretical pI: 7.03905
  • theoretical MW: 62387.5
  • GRAVY: -0.490844

Function[edit source | edit]

  • reaction:
    EC 1.1.5.3?  ExPASy
    Glycerol-3-phosphate dehydrogenasesn-glycerol 3-phosphate + a quinone = glycerone phosphate + a quinol
  • TIGRFAM:
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, A subunit (TIGR03377; EC 1.1.5.3; HMM-score: 175.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 48.2)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 33.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 31.8)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 27.4)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 23.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 22)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 19.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 18.9)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 18.3)
    lycopene cyclase family protein (TIGR01790; HMM-score: 18)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 16.1)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 16.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthertyrosine decarboxylase MnfA (TIGR03812; EC 4.1.1.25; HMM-score: 14.7)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 14.6)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, monomeric form (TIGR01377; HMM-score: 14.2)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 13.5)
    putative aminophosphonate oxidoreductase (TIGR03329; HMM-score: 13.2)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, beta subunit family (TIGR01373; HMM-score: 12.3)
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 12.2)
    MetabolismEnergy metabolismAnaerobicsuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 12.2)
    MetabolismEnergy metabolismAerobicsuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 12.2)
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase, flavoprotein subunit (TIGR01816; HMM-score: 11.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 11.6)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 11.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 10.2)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 9.7)
  • TheSEED:  
    CarbohydratesSugar alcoholsGlycerol and Glycerol-3-phosphate Uptake and Utilization Aerobic glycerol-3-phosphate dehydrogenase (EC 1.1.5.3) 
    Fatty Acids, Lipids, and IsoprenoidsPhospholipidsGlycerolipid and Glycerophospholipid Metabolism in Bacteria Aerobic glycerol-3-phosphate dehydrogenase (EC 1.1.5.3) 
    RespirationElectron donating reactionsRespiratory dehydrogenases 1 Aerobic glycerol-3-phosphate dehydrogenase (EC 1.1.5.3) 
  • PFAM:
    NADP_Rossmann (CL0063) DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 193)
    no clan definedDAO_C; C-terminal domain of alpha-glycerophosphate oxidase (PF16901; HMM-score: 83.7)
    NADP_Rossmann (CL0063) FAD_binding_3; FAD binding domain (PF01494; HMM-score: 29)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 27.9)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 23.7)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 23)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 17.7)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 17.1)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 16.3)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 16)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 12.8)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 11.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.128
    • Ymax_pos: 12
    • Cmax: 0.167
    • Cmax_pos: 38
    • Smax: 0.254
    • Smax_pos: 2
    • Smean: 0.144
    • D: 0.134
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MALSTFKREHIKKNLRNDEYDLVIIGGGITGAGIALDASERGMKVALVEMQDFAQGTSSRSTKLVHGGLRYLKQFQIGVVAETGKERAIVYENGPHVTTPEWMLLPMHKGGTFGKFSTSIGLGMYDRLAGVKKSERKKMLSKKETLAKEPLVKKEGLKGGGYYVEYRTDDARLTIEVMKRAAEKGAEIINYTKSEHFTYDKNQQVNGVKVIDKLTNENYTIKAKKVVNAAGPWVDDVRSGDYARNNKKLRLTKGVHVVIDQSKFPLGQAVYFDTEKDGRMIFAIPREGKAYVGTTDTFYDNIKSSPLTTQEDRDYLIDAINYMFPSVNVTDEDIESTWAGIRPLIYEEGKDPSEISRKDEIWEGKSGLLTIAGGKLTGYRHMAQDIVDLVSKRLKKDYGLTFSPCNTKGLAISGGDVGGSKNFDAFVEQKVDVAKGFGIDEDVARRLASKYGSNVDELFNIAQTSQYHDSKLPLEIYVELVYSIQQEMVYKPNDFLVRRSGKMYFNIKDVLDYKDAVIDIMADMLDYSPAQIEAYTEEVEQAIKEAQHGNNQPAVKE

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SAOUHSC_01850 (CcpA*)
    CcpA* (TF) important in Carbon catabolism

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]