From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01485
  • pan locus tag?: SAUPAN003929000
  • symbol: ndk
  • pan gene symbol?: ndk
  • synonym:
  • product: nucleoside diphosphate kinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_01485
  • symbol: ndk
  • product: nucleoside diphosphate kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 1442371..1442802
  • length: 432
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGATTAAACCAGATGCAGTACAAAGAAATCTAATTGGTGAAGTAATTTCAAGAATTGAA
    AGAAAAGGACTAAAACTTGTCGGTGGTAAATTAATGCAAGTACCAATGGAACTTGCTGAA
    ACACATTATGGTGAACACCAAGGTAAACCATTTTATAATGATTTAATTTCATTTATTACA
    TCAGCACCAGTGTTCGCAATGGTAGTTGAAGGTGAAGATGCAGTTAATGTATCTAGACAT
    ATTATTGGCAGCACCAATCCTTCAGAAGCTTCACCAGGATCAATTAGAGGTGATTTAGGT
    TTAACTGTTGGTAGAAATATCATTCACGGTTCAGATTCATTAGAGTCTGCTGAACGTGAA
    ATTAATCTATGGTTTAATGAAAATGAAATTACTAGCTATGCTTCACCACGTGATGCATGG
    TTATATGAATAA
    60
    120
    180
    240
    300
    360
    420
    432

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_01485
  • symbol: Ndk
  • description: nucleoside diphosphate kinase
  • length: 143
  • theoretical pI: 4.79684
  • theoretical MW: 15796.7
  • GRAVY: -0.257343

Function[edit source | edit]

  • reaction:
    EC 2.7.4.6?  ExPASy
    Nucleoside-diphosphate kinaseATP + nucleoside diphosphate = ADP + nucleoside triphosphate
  • TIGRFAM:
  • TheSEED:  
    Nucleosides and NucleotidesPurinesPurine conversions Nucleoside diphosphate kinase (EC 2.7.4.6) 
    Pyrimidinespyrimidine conversions Nucleoside diphosphate kinase (EC 2.7.4.6) 
  • PFAM:
    no clan definedNDK; Nucleoside diphosphate kinase (PF00334; HMM-score: 183.1)
    TIM_barrel (CL0036) OMPdecase; Orotidine 5'-phosphate decarboxylase / HUMPS family (PF00215; HMM-score: 11.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.167
    • Ymax_pos: 40
    • Cmax: 0.164
    • Cmax_pos: 40
    • Smax: 0.308
    • Smax_pos: 38
    • Smean: 0.124
    • D: 0.15
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MIKPDAVQRNLIGEVISRIERKGLKLVGGKLMQVPMELAETHYGEHQGKPFYNDLISFITSAPVFAMVVEGEDAVNVSRHIIGSTNPSEASPGSIRGDLGLTVGRNIIHGSDSLESAEREINLWFNENEITSYASPRDAWLYE

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]