From AureoWiki
Jump to: navigation, search

NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02803
  • pan locus tag?: SAUPAN006098000
  • symbol: SAOUHSC_02803
  • pan gene symbol?: fnbA
  • synonym:
  • product: fibronectin-binding protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_02803
  • symbol: SAOUHSC_02803
  • product: fibronectin-binding protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2581383..2584355
  • length: 2973
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    2761
    2821
    2881
    2941
    ATGGGACAAGACAAAGAAGCTGCAGCATCAGAACAAAAGACAACTACAGTAGAAGAAAAT
    GGGAATTCAGCTACTGATAATAAAACAAGTGAAACACAAACAACTGCAACTAACGTTAAT
    CATATAGAAGAAACTCAATCATATAACGCAACAGTAACAGAACAACCGTCAAACGCAACA
    CAAGTAACAACTGAAGAAGCACCAAAAGCAGTACAAGCACCACAAACTGCACAACCAGCA
    AATATAGAAACAGTTAAAGAAGAGGTAGTTAAGGAAGAAGCGAAACCTCAAGTTAAGGAA
    ACAACACAATCTCAAGACAATAGCGGAGATCAAAGACAAGTAGATTTAACACCTAAAAAG
    GCTACACAAAATCAAGTCGCAGAAACACAAGTTGAAGTGGCACAGCCAAGAACGGCATCA
    GAAAGTAAGCCACGTGTGACAAGATCAGCAGATGTAGCGGAAGCTAAGGAAGCTAGTAAC
    GCGAAAGTGGAAACGGGTACAGATGTAACAAGTAAAGTTACAGTAGAAATTGGTTCTATT
    GAGGGGCATAACAATACAAATAAAGTAGAACCTCATGCAGGACAACGAGCGGTACTAAAA
    TATAAGTTGAAATTTGAGAATGGTTTACATCAAGGTGACTACTTTGACTTTACTTTATCA
    AATAATGTAAATACGCATGGCGTATCAACTGCTAGAAAAGTACCAGAAATTAAAAATGGT
    TCAGTCGTAATGGCGACAGGTGAAGTTTTAGAAGGTGGAAAGATTAGATATACATTTACA
    AATGATATTGAAGATAAGGTTGATGTAACGGCTGAACTAGAAATTAATTTATTTATTGAT
    CCTAAAACTGTACAAACTAATGGAAATCAAACTATAACTTCAACACTAAATGAAGAACAA
    ACTTCAAAGGAATTAGATGTTAAATATAAAGATGGTATTGGGAATTATTATGCCAATTTA
    AATGGATCGATTGAGACATTTAATAAAGCGAATAATAGATTTTCGCATGTTGCATTTATT
    AAACCTAATAATGGTAAAACGACAAGTGTGACTGTTACTGGAACTTTAATGAAAGGTAGT
    AATCAGAATGGAAATCAACCAAAAGTTAGGATATTTGAATACTTGGGTAATAATGAAGAC
    ATAGCGAAGAGTGTATATGCAAATACGACAGATACTTCTAAATTTAAAGAAGTCACAAGT
    AATATGAGTGGGAATTTGAATTTACAAAATAATGGAAGCTATTCATTGAATATAGAAAAT
    CTAGATAAAACTTATGTTGTTCACTATGATGGAGAGTATTTAAATGGTACTGATGAAGTT
    GATTTTAGAACACAAATGGTAGGACATCCAGAGCAACTTTATAAGTATTATTATGATAGA
    GGATATACCTTAACTTGGGATAATGGTTTAGTTTTATACAGTAATAAAGCGAACGGAAAT
    GAGAAAAATGGTCCGATTATTCAAAATAATAAATTTGAATATAAAGAAGATACAATTAAA
    GAAACTCTTACAGGTCAATATGATAAGAATTTAGTAACTACTGTTGAAGAGGAATATGAT
    TCATCAACTCTTGACATTGATTACCACACAGCTATAGATGGTGGAGGTGGATATGTTGAT
    GGATACATTGAAACAATAGAAGAAACGGATTCATCAGCTATTGATATCGATTACCATACT
    GCTGTGGATAGCGAAGCAGGTCACGTTGGAGGATACACTGAGTCCTCTGAGGAATCAAAT
    CCAATTGACTTTGAAGAATCTACACATGAAAATTCAAAACATCACGCTGATGTTGTTGAA
    TATGAAGAAGATACAAACCCAGGTGGTGGTCAGGTTACTACTGAGTCTAACTTAGTTGAA
    TTTGACGAAGAGTCTACAAAAGGTATTGTAACTGGCGCAGTGAGCGATCATACAACAGTT
    GAAGATACGAAAGAATATACAACTGAAAGTAATCTGATTGAATTAGTGGATGAATTACCT
    GAAGAGCATGGTCAAGCACAAGGACCAGTCGAGGAAATTACTAAAAACAATCATCATATT
    TCTCATTCTGGTTTAGGAACTGAAAATGGTCACGGGAATTATGACGTGATTGAAGAAATC
    GAAGAAAATAGCCACGTTGATATTAAGAGTGAATTAGGTTATGAAGGTGGCCAAAATAGC
    GGTAACCAGTCATTCGAGGAAGACACAGAAGAAGACAAACCTAAATATGAACAAGGTGGC
    AATATCGTAGATATCGATTTTGATAGTGTACCTCAAATTCATGGTCAAAATAAAGGTAAT
    CAGTCATTCGAGGAAGATACAGAAAAAGACAAACCTAAGTATGAACATGGCGGTAACATC
    ATTGATATCGACTTCGACAGTGTGCCACATATTCACGGATTCAATAAGCACACTGAAATT
    ATTGAAGAAGATACAAATAAAGATAAACCAAGTTATCAATTCGGTGGACACAATAGTGTT
    GACTTTGAAGAAGATACACTTCCAAAAGTAAGCGGCCAAAATGAAGGTCAACAAACGATT
    GAAGAAGATACAACACCTCCAATCGTGCCACCAACGCCACCGACACCAGAAGTACCAAGT
    GAGCCGGAAACACCAACGCCACCAACACCAGAAGTACCAAGTGAGCCGGAAACACCAACA
    CCACCGACACCAGAAGTGCCGAGTGAGCCAGAAACTCCAACACCGCCAACACCAGAGGTA
    CCAGCTGAACCTGGTAAACCAGTACCACCTGCCAAAGAAGAACCTAAAAAGCCTTCTAAA
    CCAGTGGAACAAGGTAAAGTAGTAACACCTGTTATTGAAATCAATGAAAAGGTTAAAGCA
    GTGGCACCAACTAAAAAACCACAATCTAAGAAATCTGAACTACCTGAAACAGGTGGAGAA
    GAATCAACAAACAAAGGTATGTTGTTCGGCGGATTATTCAGCATTCTAGGTTTAGCATTA
    TTACGCAGAAATAAAAAGAATCACAAAGCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2760
    2820
    2880
    2940
    2973

Protein[edit source | edit]

Protein Data Bank: 2RKY
Protein Data Bank: 2RKZ
Protein Data Bank: 2RL0
Protein Data Bank: 3CAL
Protein Data Bank: 4B5Z
Protein Data Bank: 4B60

General[edit source | edit]

  • locus tag: SAOUHSC_02803
  • symbol: SAOUHSC_02803
  • description: fibronectin-binding protein
  • length: 990
  • theoretical pI: 4.28858
  • theoretical MW: 108723
  • GRAVY: -0.960101

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cell structureCell envelopeOtherLPXTG cell wall anchor domain (TIGR01167; HMM-score: 24.9)
  • TheSEED:  
    Virulence, Disease and DefenseAdhesionAdhesins in Staphylococcus Fibronectin binding protein FnbA 
  • PFAM:
    Adhesin (CL0204) SdrG_C_C; C-terminus of bacterial fibrinogen-binding adhesin (PF10425; HMM-score: 130.9)
    no clan definedFn_bind; Fibronectin binding repeat (PF02986; HMM-score: 106.8)
    Gram_pos_anchor; LPXTG cell wall anchor motif (PF00746; HMM-score: 34.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cellwall
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 10
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 0.83
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.146
    • Ymax_pos: 11
    • Cmax: 0.118
    • Cmax_pos: 60
    • Smax: 0.293
    • Smax_pos: 23
    • Smean: 0.196
    • D: 0.165
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MGQDKEAAASEQKTTTVEENGNSATDNKTSETQTTATNVNHIEETQSYNATVTEQPSNATQVTTEEAPKAVQAPQTAQPANIETVKEEVVKEEAKPQVKETTQSQDNSGDQRQVDLTPKKATQNQVAETQVEVAQPRTASESKPRVTRSADVAEAKEASNAKVETGTDVTSKVTVEIGSIEGHNNTNKVEPHAGQRAVLKYKLKFENGLHQGDYFDFTLSNNVNTHGVSTARKVPEIKNGSVVMATGEVLEGGKIRYTFTNDIEDKVDVTAELEINLFIDPKTVQTNGNQTITSTLNEEQTSKELDVKYKDGIGNYYANLNGSIETFNKANNRFSHVAFIKPNNGKTTSVTVTGTLMKGSNQNGNQPKVRIFEYLGNNEDIAKSVYANTTDTSKFKEVTSNMSGNLNLQNNGSYSLNIENLDKTYVVHYDGEYLNGTDEVDFRTQMVGHPEQLYKYYYDRGYTLTWDNGLVLYSNKANGNEKNGPIIQNNKFEYKEDTIKETLTGQYDKNLVTTVEEEYDSSTLDIDYHTAIDGGGGYVDGYIETIEETDSSAIDIDYHTAVDSEAGHVGGYTESSEESNPIDFEESTHENSKHHADVVEYEEDTNPGGGQVTTESNLVEFDEESTKGIVTGAVSDHTTVEDTKEYTTESNLIELVDELPEEHGQAQGPVEEITKNNHHISHSGLGTENGHGNYDVIEEIEENSHVDIKSELGYEGGQNSGNQSFEEDTEEDKPKYEQGGNIVDIDFDSVPQIHGQNKGNQSFEEDTEKDKPKYEHGGNIIDIDFDSVPHIHGFNKHTEIIEEDTNKDKPSYQFGGHNSVDFEEDTLPKVSGQNEGQQTIEEDTTPPIVPPTPPTPEVPSEPETPTPPTPEVPSEPETPTPPTPEVPSEPETPTPPTPEVPAEPGKPVPPAKEEPKKPSKPVEQGKVVTPVIEINEKVKAVAPTKKPQSKKSELPETGGEESTNKGMLFGGLFSILGLALLRRNKKNHKA

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]

T J Foster, M Höök
Surface protein adhesins of Staphylococcus aureus.
Trends Microbiol.: 1998, 6(12);484-8
[PubMed:10036727] [WorldCat.org] (P p)
E R Wann, S Gurusiddappa, M Hook
The fibronectin-binding MSCRAMM FnbpA of Staphylococcus aureus is a bifunctional protein that also binds to fibrinogen.
J. Biol. Chem.: 2000, 275(18);13863-71
[PubMed:10788510] [WorldCat.org] (P p)
Y A Que, P François, J A Haefliger, J M Entenza, P Vaudaux, P Moreillon
Reassessing the role of Staphylococcus aureus clumping factor and fibronectin-binding protein by expression in Lactococcus lactis.
Infect. Immun.: 2001, 69(10);6296-302
[PubMed:11553573] [WorldCat.org] [DOI] (P p)
P M Dunman, E Murphy, S Haney, D Palacios, G Tucker-Kellogg, S Wu, E L Brown, R J Zagursky, D Shlaes, S J Projan
Transcription profiling-based identification of Staphylococcus aureus genes regulated by the agr and/or sarA loci.
J. Bacteriol.: 2001, 183(24);7341-53
[PubMed:11717293] [WorldCat.org] [DOI] (P p)
R C Massey, M N Kantzanou, T Fowler, N P Day, K Schofield, E R Wann, A R Berendt, M Höök, S J Peacock
Fibronectin-binding protein A of Staphylococcus aureus has multiple, substituting, binding regions that mediate adherence to fibronectin and invasion of endothelial cells.
Cell. Microbiol.: 2001, 3(12);839-51
[PubMed:11736995] [WorldCat.org] (P p)
Christine Heilmann, Silke Niemann, Bhanu Sinha, Mathias Herrmann, Beate E Kehrel, Georg Peters
Staphylococcus aureus fibronectin-binding protein (FnBP)-mediated adherence to platelets, and aggregation of platelets induced by FnBPA but not by FnBPB.
J. Infect. Dis.: 2004, 190(2);321-9
[PubMed:15216468] [WorldCat.org] [DOI] (P p)
Fiona M Roche, Robert Downer, Fiona Keane, Pietro Speziale, Pyong Woo Park, Timothy J Foster
The N-terminal A domain of fibronectin-binding proteins A and B promotes adhesion of Staphylococcus aureus to elastin.
J. Biol. Chem.: 2004, 279(37);38433-40
[PubMed:15234962] [WorldCat.org] [DOI] (P p)
Jose-Manuel Entenza, Philippe Moreillon, Maria Magdalena Senn, Jan Kormanec, Paul M Dunman, Brigitte Berger-Bächi, Steven Projan, Markus Bischoff
Role of sigmaB in the expression of Staphylococcus aureus cell wall adhesins ClfA and FnbA and contribution to infectivity in a rat model of experimental endocarditis.
Infect. Immun.: 2005, 73(2);990-8
[PubMed:15664942] [WorldCat.org] [DOI] (P p)
Yok-Ai Que, Jacques-Antoine Haefliger, Lionel Piroth, Patrice François, Eleonora Widmer, José M Entenza, Bhanu Sinha, Mathias Herrmann, Patrick Francioli, Pierre Vaudaux, Philippe Moreillon
Fibrinogen and fibronectin binding cooperate for valve infection and invasion in Staphylococcus aureus experimental endocarditis.
J. Exp. Med.: 2005, 201(10);1627-35
[PubMed:15897276] [WorldCat.org] [DOI] (P p)
Andreas Schröder, Barbara Schröder, Bernhard Roppenser, Stefan Linder, Bhanu Sinha, Reinhard Fässler, Martin Aepfelbacher
Staphylococcus aureus fibronectin binding protein-A induces motile attachment sites and complex actin remodeling in living endothelial cells.
Mol. Biol. Cell: 2006, 17(12);5198-210
[PubMed:17021255] [WorldCat.org] [DOI] (P p)
Fiona M Keane, Anthony Loughman, Viviana Valtulina, Marian Brennan, Pietro Speziale, Timothy J Foster
Fibrinogen and elastin bind to the same region within the A domain of fibronectin binding protein A, an MSCRAMM of Staphylococcus aureus.
Mol. Microbiol.: 2007, 63(3);711-23
[PubMed:17302800] [WorldCat.org] [DOI] (P p)
Fiona M Keane, Adam W Clarke, Timothy J Foster, Anthony S Weiss
The N-terminal A domain of Staphylococcus aureus fibronectin-binding protein A binds to tropoelastin.
Biochemistry: 2007, 46(24);7226-32
[PubMed:17516661] [WorldCat.org] [DOI] (P p)
Richard J Bingham, Enrique Rudiño-Piñera, Nicola A G Meenan, Ulrich Schwarz-Linek, Johan P Turkenburg, Magnus Höök, Elspeth F Garman, Jennifer R Potts
Crystal structures of fibronectin-binding sites from Staphylococcus aureus FnBPA in complex with fibronectin domains.
Proc. Natl. Acad. Sci. U.S.A.: 2008, 105(34);12254-8
[PubMed:18713862] [WorldCat.org] [DOI] (I p)
C Signäs, G Raucci, K Jönsson, P E Lindgren, G M Anantharamaiah, M Höök, M Lindberg
Nucleotide sequence of the gene for a fibronectin-binding protein from Staphylococcus aureus: use of this peptide sequence in the synthesis of biologically active peptides.
Proc. Natl. Acad. Sci. U.S.A.: 1989, 86(2);699-703
[PubMed:2521391] [WorldCat.org] (P p)
P Saravia-Otten, H P Müller, S Arvidson
Transcription of Staphylococcus aureus fibronectin binding protein genes is negatively regulated by agr and an agr-independent mechanism.
J. Bacteriol.: 1997, 179(17);5259-63
[PubMed:9286974] [WorldCat.org] (P p)