From AureoWiki
Jump to: navigation, search

NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02881
  • pan locus tag?: SAUPAN006228000
  • symbol: SAOUHSC_02881
  • pan gene symbol?: crtP
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_02881
  • symbol: SAOUHSC_02881
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2654320..2655813
  • length: 1494
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    ATGACTAAACATATCATCGTTATTGGTGGTGGCTTAGGTGGGATTTCTGCAGCAATTCGA
    ATGGCACAAAGTGGCTATTCGGTCTCATTATATGAACAAAATAATCATATAGGAGGCAAA
    GTGAATCGTCATGAATCAGATGGCTTTGGCTTTGATTTAGGTCCATCTATTTTAACGATG
    CCTTATATTTTTGAAAAATTATTCGAATATAGCAAGAAGCAAATGTCAGACTACGTTACA
    ATCAAGCGATTGCCACATCAATGGCGTAGCTTTTTTCCAGATGGAACGACTATCGATTTG
    TATGAAGGTATTAAAGAAACAGGTCAGCATAATGCGATATTGTCGAAACAGGATATAGAG
    GAACTGCAAAATTATTTGAATTATACAAGACGAATCGATCGTATTACTGAAAAAGGGTAT
    TTCAACTATGGTTTAGATACACTATCTCAAATTATTAAATTTCATGGGCCATTAAATGCT
    CTTATTAATTATGATTATGTACATACTATGCAACAGGCCATAGACAAGCGTATCTCGAAT
    CCATACTTGCGACAAATGTTAGGCTATTTTATCAAATATGTAGGTTCTTCATCATACGAT
    GCGCCAGCTGTATTATCTATGTTATTCCATATGCAACAAGAGCAAGGCCTTTGGTATGTA
    GAAGGTGGAATCCATCATTTAGCCAATGCCTTGGAAAAGCTAGCGCGTGAAGAAGGTGTC
    ACAATTCATACAGGTGCACGTGTGGACAATATTAAAACATATCAAAGACGTGTGACGGGT
    GTCAGATTAGATACAGGTGAGTTTGTAAAGGCAGATTATATTATTTCAAATATGGAAGTC
    ATACCTACTTATAAATATTTAATTCACCTTGATACTCAACGATTAAACAAATTAGAGAGG
    GAATTTGAGCCGGCAAGCTCAGGATATGTGATGCATTTAGGTGTTGCTTGCCAATACCCG
    CAATTAGCACATCATAATTTCTTTTTTACGGAAAATGCTTATCTCAATTATCAACAAGTT
    TTTCATGAAAAGGTATTGCCAGATGATCCGACCATTTATCTAGTAAATACGAATAAAACT
    GATCACACACAAGCGCCAGTAGGTTATGAAAATATCAAAGTCTTACCACATATTCCATAT
    ATTCAAGATCAGCCTTTTACCACTGAAGATTATGCGAAGTTTAGGGATAAAATTTTGGAT
    AAATTAGAAAAAATGGGACTTACTGATTTAAGAAAACACATTATTTATGAAGATGTTTGG
    ACACCGGAGGATATTGAAAAAAATTATCGTTCTAATCGTGGTGCAATATATGGTGTTGTA
    GCAGATAAAAAGAAAAACAAAGGATTTAAATTTCCTAAAGAAAGTCAGTATTTTGAAAAC
    TTGTACTTTGTAGGTGGATCAGTAAATCCTGGTGGTGGCATGCCAATGGTTACATTAAGT
    GGGCAACAAGTCGCAGACAAAATAAACGCGCGAGAAGCGAAGAATAGGAAGTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1494

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_02881
  • symbol: SAOUHSC_02881
  • description: hypothetical protein
  • length: 497
  • theoretical pI: 7.93809
  • theoretical MW: 57186.6
  • GRAVY: -0.491549

Function[edit source | edit]

  • reaction:
    EC 1.14.99.44?  ExPASy
    Diapolycopene oxygenase4,4'-diapolycopene + 4 AH2 + 4 O2 = 4,4'-diapolycopenedial + 4 A + 6 H2O
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 330.4)
    and 43 more
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercarotene isomerase (TIGR02730; EC 5.-.-.-; HMM-score: 96.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 87.6)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 39.9)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 36.7)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 34.7)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 33.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprotoporphyrinogen oxidase (TIGR00562; EC 1.3.3.4; HMM-score: 30.9)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 30.1)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 28.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 25.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprecorrin 3B synthase CobZ (TIGR02485; HMM-score: 22.3)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA:m(5)U-54 methyltransferase (TIGR00137; EC 2.1.1.74; HMM-score: 22.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 20.7)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 19)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 18.3)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 18.3)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 17.2)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 16.1)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 15.7)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 15.7)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 15.5)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesUDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 15)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 14.8)
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01811; EC 1.3.99.1; HMM-score: 14.7)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 14.1)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 14)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 13.9)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 13.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 13.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02731; EC 1.14.99.-; HMM-score: 13.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 13.1)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, monomeric form (TIGR01377; HMM-score: 12.8)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 12.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 12.2)
    Unknown functionEnzymes of unknown specificityGMC family mycofactocin-associated oxidreductase (TIGR04542; EC 1.-.-.-; HMM-score: 12.1)
    lycopene cyclase family protein (TIGR01790; HMM-score: 11.7)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 11.5)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 11)
    MetabolismAmino acid biosynthesisOtherpyrrolysine biosynthesis protein PylD (TIGR03911; HMM-score: 10.9)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 10.8)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 10.3)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 10.1)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, A subunit (TIGR03377; EC 1.1.5.3; HMM-score: 9.1)
  • TheSEED:  
    Carotenoids Phytoene desaturase, neurosporene or lycopene producing (EC 1.3.-.-) / 4,4'-diapolycopene oxidase 
  • PFAM:
    NADP_Rossmann (CL0063) Amino_oxidase; Flavin containing amine oxidoreductase (PF01593; HMM-score: 91.3)
    and 15 more
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 53.7)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 43.8)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 42.8)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 36.5)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 36.2)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 35.1)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 34.2)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 30.5)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 17.3)
    Trp_halogenase; Tryptophan halogenase (PF04820; HMM-score: 13.8)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 13.4)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 12.6)
    Thi4; Thi4 family (PF01946; HMM-score: 12.3)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 12.1)
    MCRA; MCRA family (PF06100; HMM-score: 11.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 0.67
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.188
    • Ymax_pos: 25
    • Cmax: 0.144
    • Cmax_pos: 25
    • Smax: 0.376
    • Smax_pos: 20
    • Smean: 0.218
    • D: 0.2
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTKHIIVIGGGLGGISAAIRMAQSGYSVSLYEQNNHIGGKVNRHESDGFGFDLGPSILTMPYIFEKLFEYSKKQMSDYVTIKRLPHQWRSFFPDGTTIDLYEGIKETGQHNAILSKQDIEELQNYLNYTRRIDRITEKGYFNYGLDTLSQIIKFHGPLNALINYDYVHTMQQAIDKRISNPYLRQMLGYFIKYVGSSSYDAPAVLSMLFHMQQEQGLWYVEGGIHHLANALEKLAREEGVTIHTGARVDNIKTYQRRVTGVRLDTGEFVKADYIISNMEVIPTYKYLIHLDTQRLNKLEREFEPASSGYVMHLGVACQYPQLAHHNFFFTENAYLNYQQVFHEKVLPDDPTIYLVNTNKTDHTQAPVGYENIKVLPHIPYIQDQPFTTEDYAKFRDKILDKLEKMGLTDLRKHIIYEDVWTPEDIEKNYRSNRGAIYGVVADKKKNKGFKFPKESQYFENLYFVGGSVNPGGGMPMVTLSGQQVADKINAREAKNRK

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor: SAOUHSC_02298 regulon (SigB*) [3] [4] other strains
    SigB*(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J. Bacteriol.: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  4. 4.0 4.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]

Luan Tao, Andreas Schenzle, J Martin Odom, Qiong Cheng
Novel carotenoid oxidase involved in biosynthesis of 4,4'-diapolycopene dialdehyde.
Appl. Environ. Microbiol.: 2005, 71(6);3294-301
[PubMed:15933032] [WorldCat.org] [DOI] (P p)