From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02877
  • pan locus tag?: SAUPAN006225000
  • symbol: SAOUHSC_02877
  • pan gene symbol?: crtN
  • synonym:
  • product: squalene synthase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_02877
  • symbol: SAOUHSC_02877
  • product: squalene synthase
  • replicon: chromosome
  • strand: -
  • coordinates: 2650767..2652275
  • length: 1509
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    ATGAAGATTGCAGTAATTGGTGCAGGTGTCACAGGATTAGCAGCGGCAGCCCGTATTGCT
    TCTCAAGGTCATGAAGTGACGATATTTGAAAAAAATAATAATGTAGGCGGGCGTATGAAT
    CAATTAAAGAAAGACGGCTTTACATTTGATATGGGTCCCACAATTGTCATGATGCCAGAT
    GTTTATAAAGATGTTTTTACAGCGTGTGGTAAAAATTATGAAGATTATATTGAATTGAGA
    CAATTACGTTATATTTACGATGTGTATTTTGACCACGATGATCGTATAACGGTGCCTACA
    GATTTAGCTGAATTACAGCAAATGCTAGAAAGTATAGAACCTGGTTCAACGCATGGTTTT
    ATGTCCTTTTTAACGGATGTTTATAAAAAATATGAAATTGCACGTCGCTATTTCTTAGAA
    AGAACGTATCGCAAACCGAGTGACTTTTATAATATGACGTCACTTGTGCAAGGTGCTAAG
    TTAAAAACGTTAAATCATGCAGATCAGCTAATTGAACATTATATTGATAACGAAAAGATA
    CAAAAGCTTTTAGCGTTTCAAACGTTATACATAGGAATTGATCCAAAACGAGGCCCGTCA
    CTATATTCAATTATTCCTATGATTGAAATGATGTTTGGTGTGCATTTTATTAAAGGCGGT
    ATGTATGGCATGGCTCAAGGGCTAGCGCAATTAAATAAAGACTTAGGCGTTAATATTGAA
    CTAAATGCTGAAATTGAGCAAATTATTATTGATCCTAAATTCAAACGGGCCGATGCGATA
    AAAGTGAATGGTGACATAAGAAAATTTGATAAAATTTTATGTACGGCTGATTTCCCTAGT
    GTTGCGGAATCATTAATGCCAGATTTTGCACCTATTAAAAAGTATCCACCACATAAAATT
    GCAGACTTAGATTACTCTTGTTCAGCATTTTTAATGTATATCGGTATAGATATTGATGTG
    ACAGATCAAGTGAGACTTCATAATGTTATTTTTTCAGATGACTTTAGAGGCAATATTGAA
    GAAATATTTGAGGGACGTTTATCATATGATCCTTCTATTTATGTGTATGTACCAGCGGTC
    GCTGATAAATCACTTGCGCCAGAAGGCAAAACTGGTATTTATGTGCTAATGCCGACGCCG
    GAACTTAAAACAGGTAGCGGAATCGATTGGTCAGATGAAGCTTTGACGCAACAAATAAAG
    GAAATTATTTATCGTAAATTAGCAACGATTGAAGTATTTGAAGATATAAAATCGCATATT
    GTTTCAGAAACAATCTTTACGCCAAATGATTTTGAGCAAACGTATCATGCGAAATTTGGT
    TCGGCATTCGGTTTAATGCCAACTTTAGCGCAAAGTAATTATTATCGTCCACAAAATGTA
    TCGCGAGATTATAAAGATTTATATTTTGCAGGTGCAAGTACGCATCCAGGTGCAGGCGTT
    CCTATTGTCTTAACGAGTGCGAAAATAACTGTAGATGAAATGATTAAAGATATTGAGCGG
    GGCGTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1509

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_02877
  • symbol: SAOUHSC_02877
  • description: squalene synthase
  • length: 502
  • theoretical pI: 5.15038
  • theoretical MW: 56741.7
  • GRAVY: -0.17012

Function[edit source | edit]

  • reaction:
    EC 1.3.8.2?  ExPASy
    4,4'-diapophytoene desaturase (4,4'-diapolycopene-forming)15-cis-4,4'-diapophytoene + 4 FAD = all-trans-4,4'-diapolycopene + 4 FADH2
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 437.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 79.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercarotene isomerase (TIGR02730; EC 5.-.-.-; HMM-score: 75)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprotoporphyrinogen oxidase (TIGR00562; EC 1.3.3.4; HMM-score: 47.5)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 43.9)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 32.7)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 31.6)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 30)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 27.9)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 26.5)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 26.5)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 26)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesUDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 25.8)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 25.2)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 24.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 23.5)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 21.8)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 21)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 18.8)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 18.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 17.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02731; EC 1.14.99.-; HMM-score: 17.6)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 17.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 16.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme A2-dehydropantoate 2-reductase (TIGR00745; EC 1.1.1.-; HMM-score: 15)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 14.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridine nucleotidesL-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 13.4)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 13.4)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 13.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 13)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA:m(5)U-54 methyltransferase (TIGR00137; EC 2.1.1.74; HMM-score: 12.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprecorrin 3B synthase CobZ (TIGR02485; HMM-score: 12.6)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 12.4)
    MetabolismEnergy metabolismPentose phosphate pathway6-phosphogluconate dehydrogenase (decarboxylating) (TIGR00872; EC 1.1.1.44; HMM-score: 11.8)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanUDP-N-acetylmuramoylalanine--D-glutamate ligase (TIGR01087; EC 6.3.2.9; HMM-score: 11.3)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 11.3)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 11)
    3-hydroxyacyl-CoA dehydrogenase PaaC (TIGR02279; EC 1.1.1.-; HMM-score: 10.9)
    MetabolismEnergy metabolismElectron transportNAD(P)(+) transhydrogenase (AB-specific), alpha subunit (TIGR00561; EC 1.6.1.2; HMM-score: 10.5)
    lycopene cyclase family protein (TIGR01790; HMM-score: 10.5)
  • TheSEED:  
    Polyprenyl Diphosphate Biosynthesis Dehydrosqualene desaturase (EC 1.3.8.2) 
  • PFAM:
    NADP_Rossmann (CL0063) Amino_oxidase; Flavin containing amine oxidoreductase (PF01593; HMM-score: 98.7)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 57.1)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 29)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 26.2)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 24.8)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 24)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 23.9)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 22)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 21.7)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 20.6)
    FMO-like; Flavin-binding monooxygenase-like (PF00743; HMM-score: 20.5)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 20.3)
    NAD_Gly3P_dh_N; NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus (PF01210; HMM-score: 19.1)
    Thi4; Thi4 family (PF01946; HMM-score: 17.9)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 17.7)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 17.5)
    NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 16.1)
    ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 15.9)
    MCRA; MCRA family (PF06100; HMM-score: 15.7)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 14.8)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 13.9)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 13.4)
    no clan definedBromodomain; Bromodomain (PF00439; HMM-score: 12.9)
    NADP_Rossmann (CL0063) IlvN; Acetohydroxy acid isomeroreductase, NADPH-binding domain (PF07991; HMM-score: 12.6)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 12.4)
    no clan definedKilA-N; KilA-N domain (PF04383; HMM-score: 12.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.5
    • Signal Peptide Possibility: 0
    • N-terminally Anchored Score: 7
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.294
    • Ymax_pos: 24
    • Cmax: 0.165
    • Cmax_pos: 24
    • Smax: 0.731
    • Smax_pos: 19
    • Smean: 0.478
    • D: 0.366
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKIAVIGAGVTGLAAAARIASQGHEVTIFEKNNNVGGRMNQLKKDGFTFDMGPTIVMMPDVYKDVFTACGKNYEDYIELRQLRYIYDVYFDHDDRITVPTDLAELQQMLESIEPGSTHGFMSFLTDVYKKYEIARRYFLERTYRKPSDFYNMTSLVQGAKLKTLNHADQLIEHYIDNEKIQKLLAFQTLYIGIDPKRGPSLYSIIPMIEMMFGVHFIKGGMYGMAQGLAQLNKDLGVNIELNAEIEQIIIDPKFKRADAIKVNGDIRKFDKILCTADFPSVAESLMPDFAPIKKYPPHKIADLDYSCSAFLMYIGIDIDVTDQVRLHNVIFSDDFRGNIEEIFEGRLSYDPSIYVYVPAVADKSLAPEGKTGIYVLMPTPELKTGSGIDWSDEALTQQIKEIIYRKLATIEVFEDIKSHIVSETIFTPNDFEQTYHAKFGSAFGLMPTLAQSNYYRPQNVSRDYKDLYFAGASTHPGAGVPIVLTSAKITVDEMIKDIERGV

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor: SAOUHSC_02298 (SigB*) [3] [4] other strains
    SigB* (sigma factor) controls a large regulon involved in stress/starvation response and adaptation
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. 3.0 3.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)
  4. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J. Bacteriol.: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)

Relevant publications[edit source | edit]