From AureoWiki
Jump to: navigation, search

NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1758 [new locus tag: SAUSA300_RS09620 ]
  • pan locus tag?: SAUPAN004567000
  • symbol: splA
  • pan gene symbol?: splA
  • synonym:
  • product: serine protease SplA

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_1758 [new locus tag: SAUSA300_RS09620 ]
  • symbol: splA
  • product: serine protease SplA
  • replicon: chromosome
  • strand: -
  • coordinates: 1942963..1943670
  • length: 708
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAATAAAAATGTAATGGTTAAAGGTTTAACTGCTTTAACTATTTTAACATCTCTTGGT
    TTTGCTGAAAATATTTCTAATCAGCCTCATTCAATTGCCAAAGCAGAAAAGAATGTCAAA
    GAAATTACCGATGCAACTAAGGAACCATACAATTCAGTGGTAGCATTTGTGGGTGGTACT
    GGTGTAGTTGTTGGTAAAAATACAATCGTAACTAACAAACATATCGCTAAAAGTAATGAT
    ATTTTTAAAAATAGAGTATCAGCACATCATTCGAGTAAAGGTAAAGGCGGAGGAAACTAC
    GACGTTAAAGACATTGTAGAATATCCCGGAAAAGAAGACCTTGCGATAGTTCATGTTCAT
    GAAACAAGTACAGAAGGTTTGAATTTTAATAAGAACGTTAGTTATACAAAATTTGCAGAC
    GGAGCAAAAGTGAAAGATAGAATTTCTGTTATTGGTTATCCAAAGGGTGCACAAACAAAA
    TATAAAATGTTTGAATCGACAGGAACGATTAACCATATCAGTGGAACGTTTATGGAATTT
    GATGCGTATGCACAACCAGGTAATTCAGGATCTCCTGTATTGAATTCTAAACATGAACTG
    ATTGGTATTTTATATGCAGGTAGTGGAAAAGATGAATCTGAAAAGAATTTCGGTGTTTAT
    TTCACACCACAATTAAAAGAATTTATTCAAAATAATATTGAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    708

Protein[edit source | edit]

Protein Data Bank: 2W7S
Protein Data Bank: 2W7U
Protein Data Bank: 3UFA
Protein Data Bank: 4MVN

General[edit source | edit]

  • locus tag: SAUSA300_1758 [new locus tag: SAUSA300_RS09620 ]
  • symbol: SplA
  • description: serine protease SplA
  • length: 235
  • theoretical pI: 9.51102
  • theoretical MW: 25548.6
  • GRAVY: -0.431064

Function[edit source | edit]

  • reaction:
    EC 3.4.21.19?  ExPASy
    Glutamyl endopeptidasePreferential cleavage: Glu-|-Xaa, Asp-|-Xaa
  • TIGRFAM:
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesperiplasmic serine peptidase DegS (TIGR02038; EC 3.4.21.-; HMM-score: 29.1)
    Signal transductionRegulatory functionsProtein interactionsperiplasmic serine peptidase DegS (TIGR02038; EC 3.4.21.-; HMM-score: 29.1)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidespeptidase Do (TIGR02037; EC 3.4.21.-; HMM-score: 24.4)
    Genetic information processingProtein fateProtein folding and stabilizationpeptidase Do (TIGR02037; EC 3.4.21.-; HMM-score: 24.4)
  • TheSEED:  
    serine protease 
  • PFAM:
    Peptidase_PA (CL0124) Trypsin; Trypsin (PF00089; HMM-score: 73.9)
    Trypsin_2; Trypsin-like peptidase domain (PF13365; HMM-score: 59.5)
    Peptidase_S46; Peptidase S46 (PF10459; HMM-score: 24.5)
    Peptidase_S32; Equine arteritis virus serine endopeptidase S32 (PF05579; HMM-score: 20.4)
    Peptidase_S7; Peptidase S7, Flavivirus NS3 serine protease (PF00949; HMM-score: 19.4)
    DUF31; Putative peptidase (DUF31) (PF01732; HMM-score: 16.4)
    Peptidase_S39; Peptidase S39 (PF02122; HMM-score: 12.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.18
    • Extracellular Score: 9.73
    • Internal Helices: 0
  • LocateP: Secretory(released) (with CS)
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: 0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: NISNQPHS
  • SignalP: Signal peptide length 36 aa
    • Ymax: 0.427
    • Ymax_pos: 36
    • Cmax: 0.393
    • Cmax_pos: 36
    • Smax: 0.831
    • Smax_pos: 2
    • Smean: 0.637
    • D: 0.509
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNKNVMVKGLTALTILTSLGFAENISNQPHSIAKAEKNVKEITDATKEPYNSVVAFVGGTGVVVGKNTIVTNKHIAKSNDIFKNRVSAHHSSKGKGGGNYDVKDIVEYPGKEDLAIVHVHETSTEGLNFNKNVSYTKFADGAKVKDRISVIGYPKGAQTKYKMFESTGTINHISGTFMEFDAYAQPGNSGSPVLNSKHELIGILYAGSGKDESEKNFGVYFTPQLKEFIQNNIEK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SaeR
    SaeR (TF) important in Virulence  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]