From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS12455 [old locus tag: SAUSA300_2255 ]
  • pan locus tag?: SAUPAN005778000
  • symbol: SAUSA300_RS12455
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_RS12455 [old locus tag: SAUSA300_2255 ]
  • symbol: SAUSA300_RS12455
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2421826..2422950
  • length: 1125
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_007793 (2421826..2422950) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGAAGATAGCAATTATAGGTGCAGGCATCGGTGGATTAACAGCTGCTGCATTATTACAA
    GAACAAGGTCATACTATTAAAGTCTTTGAAAAAAATGAGTCAGTTAAAGAAATTGGCGCT
    GGGATTGGTATCGGAGATAATGTGCTTAAAAAACTAGGTAATCATGACTTAGCTAAAGGT
    ATTAAAAATGCTGGGCAAATCTTATCTACAATGACAGTGTTAGATGACAAAGATCGCCTG
    TTAACTACTGTTAAATTAAAAAGTAATACATTGAATGTGACGTTACCACGCCAAACATTA
    ATTGACATTATTAAATCTTATGTAAAAGATGACGCAATATTTACAAATCATGAAGTCACG
    CATATAGATAATGAGACAGATAAAGTTACCATACATTTCGCGGAACAAGAAAGTGAAGCA
    TTTGATTTATGTATTGGTGCTGATGGAATTCATTCTAAAGTGAGACAATCTGTAAATGCT
    GACAGTAAAGTATTATATCAAGGGTATACATGCTTTAGAGGTTTAATTGATGATATTGAT
    TTAAAGCATCCAGATTGTGCAAAAGAATACTGGGGAAGAAAAGGAAGAGTAGGTATTGTT
    CCGTTATTAAATAATCAAGCATATTGGTTCATTACAATTAACTCGAAGGAAAACAATCAT
    AAATATAGTTCGTTTGGTAAACCTCATTTGCAAGCATACTTTAATCACTATCCAAATGAA
    GTTAGAGAGATCTTAGACAAACAAAGTGAAACAGGTATCTTATTGCATAATATTTATGAT
    TTGAAACCACTCAAATCTTTTGTTTATGGTCGTACTATTTTACTAGGAGATGCAGCACAT
    GCGACAACGCCTAATATGGGGCAAGGTGCTGGACAAGCAATGGAAGATGCTATCGTATTA
    GTAAATTGTTTTAACGCATACGACTTTGAAAAAGCATTACAGCGTTATGATAAAATACGT
    GTCAAACATACTGCAAAAGTAATTAAGCGTTCTAGAAAAATCGGTAAAATTGCCCAATAT
    CGTAGTCGTTTATTTGTTGCAGTTAGAAATCGTATTATGAAAATGATGCCAAATGCATTA
    GCAGCTGGACAAACTAAATTCTTATATAAATCGAAAGAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1125

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_RS12455 [old locus tag: SAUSA300_2255 ]
  • symbol: SAUSA300_RS12455
  • description: hypothetical protein
  • length: 374
  • theoretical pI: 9.81248
  • theoretical MW: 41890
  • GRAVY: -0.317914

Function[edit source | edit]

  • reaction:
    EC 1.14.13.-?  ExPASy
  • TIGRFAM:
    salicylate 1-monooxygenase (TIGR03219; EC 1.14.13.1; HMM-score: 117.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 87.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 80.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 56.8)
    MetabolismEnergy metabolismOther4-hydroxybenzoate 3-monooxygenase (TIGR02360; EC 1.14.13.2; HMM-score: 48.1)
    ubiquinone biosynthesis monooxygenase COQ6 (TIGR01989; EC 1.14.13.-; HMM-score: 45.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 43)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 26.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 25.5)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 23.6)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 22.6)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 21.3)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 21)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 18.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 18.8)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 18.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 17.5)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 17.3)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 17.1)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 16.9)
    putative phosphonate catabolism associated alcohol dehydrogenase (TIGR03366; HMM-score: 15.7)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 14.6)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 14.4)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 13.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02028; HMM-score: 13.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02731; EC 1.14.99.-; HMM-score: 13)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 9.8)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) FAD_binding_3; FAD binding domain (PF01494; HMM-score: 72.4)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 33.3)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 23.3)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 22.3)
    SE; Squalene epoxidase (PF08491; HMM-score: 21.8)
    Amino_oxidase; Flavin containing amine oxidoreductase (PF01593; HMM-score: 21.6)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 19.7)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 18.2)
    Thi4; Thi4 family (PF01946; HMM-score: 17.2)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 16.2)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 16.2)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 16)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 15.7)
    NAD_Gly3P_dh_N; NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus (PF01210; HMM-score: 15.1)
    Trp_halogenase; Tryptophan halogenase (PF04820; HMM-score: 13.7)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 13.5)
    ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 13.3)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 12.8)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 12.8)
    NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 11.4)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.198
    • Ymax_pos: 27
    • Cmax: 0.127
    • Cmax_pos: 29
    • Smax: 0.464
    • Smax_pos: 17
    • Smean: 0.297
    • D: 0.237
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446606795 NCBI
  • RefSeq: WP_000684141 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKIAIIGAGIGGLTAAALLQEQGHTIKVFEKNESVKEIGAGIGIGDNVLKKLGNHDLAKGIKNAGQILSTMTVLDDKDRLLTTVKLKSNTLNVTLPRQTLIDIIKSYVKDDAIFTNHEVTHIDNETDKVTIHFAEQESEAFDLCIGADGIHSKVRQSVNADSKVLYQGYTCFRGLIDDIDLKHPDCAKEYWGRKGRVGIVPLLNNQAYWFITINSKENNHKYSSFGKPHLQAYFNHYPNEVREILDKQSETGILLHNIYDLKPLKSFVYGRTILLGDAAHATTPNMGQGAGQAMEDAIVLVNCFNAYDFEKALQRYDKIRVKHTAKVIKRSRKIGKIAQYRSRLFVAVRNRIMKMMPNALAAGQTKFLYKSKEK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAUSA300_RS12455 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]