From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2206 [new locus tag: NWMN_RS12730 ]
  • pan locus tag?: SAUPAN005778000
  • symbol: NWMN_2206
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_2206 [new locus tag: NWMN_RS12730 ]
  • symbol: NWMN_2206
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2426340..2427464
  • length: 1125
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGAAGATAGCAATTATAGGTGCAGGCATCGGTGGATTAACAGCTGCTGCATTATTACAA
    GAACAAGGTCATACTATTAAAGTCTTTGAAAAAAATGAGTCAGTTAAAGAAATTGGCGCT
    GGGATTGGTATCGGAGATAATGTGCTTAAAAAACTAGGTAATCATGACTTAGCTAAAGGT
    ATTAAAAATGCTGGGCAAATCTTATCTACAATGACAGTGTTAGATGACAAAGATCGCCTG
    TTAACTACTGTTAAATTAAAAAGTAATACATTGAATGTGACGTTACCACGCCAAACATTA
    ATTGACATTATTAAATCTTATGTAAAAGATGACGCAATATTTACAAATCATGAAGTCACG
    CATATAGATAATGAGACAGATAAAGTTACCATACATTTCGCGGAACAAGAAAGTGAAGCA
    TTTGATTTATGTATTGGTGCTGATGGAATTCATTCTAAAGTGAGACAATCTGTAAATGCT
    GACAGTAAAGTATTATATCAAGGGTATACATGCTTTAGAGGTTTAATTGATGATATTGAT
    TTAAAGCATCCAGATTGTGCAAAAGAATACTGGGGAAGAAAAGGAAGAGTAGGTATTGTT
    CCGTTATTAAATAATCAAGCATATTGGTTCATTACAATTAACTCGAAGGAAAACAATCAT
    AAATATAGTTCGTTTGGTAAACCTCATTTGCAAGCATACTTTAATCACTATCCAAATGAA
    GTTAGAGAGATCTTAGACAAACAAAGTGAAACAGGTATCTTATTGCATAATATTTATGAT
    TTGAAACCACTCAAATCTTTTGTTTATGGTCGTACTATTTTACTAGGAGATGCAGCACAT
    GCGACAACGCCTAATATGGGGCAAGGTGCTGGACAAGCAATGGAAGATGCTATCGTATTA
    GTAAATTGTTTTAACGCATACGACTTTGAAAAAGCATTACAGCGTTATGATAAAATACGT
    GTCAAACATACTGCAAAAGTAATTAAGCGTTCTAGAAAAATCGGTAAAATTGCCCAATAT
    CGTAGTCGTTTATTTGTTGCAGTTAGAAATCGTATTATGAAAATGATGCCAAATGCATTA
    GCAGCTGGACAAACTAAATTCTTATATAAATCGAAAGAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1125

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_2206 [new locus tag: NWMN_RS12730 ]
  • symbol: NWMN_2206
  • description: hypothetical protein
  • length: 374
  • theoretical pI: 9.81248
  • theoretical MW: 41890
  • GRAVY: -0.317914

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    salicylate 1-monooxygenase (TIGR03219; EC 1.14.13.1; HMM-score: 117.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 87.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 80.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 56.8)
    MetabolismEnergy metabolismOther4-hydroxybenzoate 3-monooxygenase (TIGR02360; EC 1.14.13.2; HMM-score: 48.1)
    ubiquinone biosynthesis monooxygenase COQ6 (TIGR01989; EC 1.14.13.-; HMM-score: 45.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 43)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 26.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 25.5)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 23.6)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 22.6)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 21.3)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 21)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 18.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 18.8)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 18.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 17.5)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 17.3)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 17.1)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 16.9)
    putative phosphonate catabolism associated alcohol dehydrogenase (TIGR03366; HMM-score: 15.7)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 14.6)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 14.4)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 13.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02028; HMM-score: 13.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02731; EC 1.14.99.-; HMM-score: 13)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 9.8)
  • TheSEED:  
    Metabolism of Aromatic CompoundsMetabolism of Aromatic Compounds - no subcategoryGentisate degradation Salicylate hydroxylase (EC 1.14.13.1) 
    Metabolism of central aromatic intermediatesSalicylate and gentisate catabolism Salicylate hydroxylase (EC 1.14.13.1) 
    Peripheral pathways for catabolism of aromatic compoundsSalicylate ester degradation Salicylate hydroxylase (EC 1.14.13.1) 
  • PFAM:
    NADP_Rossmann (CL0063) FAD_binding_3; FAD binding domain (PF01494; HMM-score: 72.4)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 33.3)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 23.3)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 22.3)
    SE; Squalene epoxidase (PF08491; HMM-score: 21.8)
    Amino_oxidase; Flavin containing amine oxidoreductase (PF01593; HMM-score: 21.6)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 19.7)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 18.2)
    Thi4; Thi4 family (PF01946; HMM-score: 17.2)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 16.2)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 16.2)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 16)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 15.7)
    NAD_Gly3P_dh_N; NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus (PF01210; HMM-score: 15.1)
    Trp_halogenase; Tryptophan halogenase (PF04820; HMM-score: 13.7)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 13.5)
    ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 13.3)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 12.8)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 12.8)
    NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 11.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_0372(ahpC)alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    NWMN_2534(arcA)arginine deiminase  [1] (data from MRSA252)
    NWMN_1365(asnC)asparaginyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_1587(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    NWMN_0736(clpP)ATP-dependent Clp protease proteolytic subunit  [1] (data from MRSA252)
    NWMN_2042(deoD)purine nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_1483(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_0002(dnaN)DNA polymerase III subunit beta  [1] (data from MRSA252)
    NWMN_0745(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    NWMN_0551(eutD)phosphotransacetylase  [1] (data from MRSA252)
    NWMN_2029(fbaA)fructose-bisphosphate aldolase  [1] (data from MRSA252)
    NWMN_1625(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    NWMN_2163(fmhB)peptidoglycan pentaglycine interpeptide biosynthesis protein  [1] (data from MRSA252)
    NWMN_1096(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_0741(gapA)glyceraldehyde 3-phosphate dehydrogenase 1  [1] (data from MRSA252)
    NWMN_1580(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    NWMN_1838(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    NWMN_1837(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    NWMN_2056(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    NWMN_1217(glnA)glutamine synthetase  [1] (data from MRSA252)
    NWMN_1468(glyS)glycyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_2315(gpmA)phosphoglyceromutase  [1] (data from MRSA252)
    NWMN_1937(groEL)chaperonin GroEL  [1] (data from MRSA252)
    NWMN_0380(guaB)inosine-5'-monophosphate dehydrogenase  [1] (data from MRSA252)
    NWMN_0828(gudB)NAD-specific glutamate dehydrogenase  [1] (data from MRSA252)
    NWMN_1178(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    NWMN_1574(infC)translation initiation factor IF-3  [1] (data from MRSA252)
    NWMN_2499(ldh)L-lactate dehydrogenase 2  [1] (data from MRSA252)
    NWMN_0176(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    NWMN_0479(lysS)lysyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_2028(murZ)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    NWMN_0961(pdhC)branched-chain alpha-keto acid dehydrogenase subunit E2  [1] (data from MRSA252)
    NWMN_0962(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    NWMN_2040(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_1593(pfk)6-phosphofructokinase  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0833(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    NWMN_0742(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_0960(phdB)pyruvate dehydrogenase E1 component, beta subunit  [1] (data from MRSA252)
    NWMN_1183(pnpA)polynucleotide phosphorylase/polyadenylase  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_1401(rluB)ribosomal large subunit pseudouridine synthase B  [1] (data from MRSA252)
    NWMN_0500(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_2149(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    NWMN_2152(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    NWMN_2151(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    NWMN_2140(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    NWMN_2137(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_0499(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    NWMN_0502(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    NWMN_2120(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    NWMN_2133(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    NWMN_2125(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    NWMN_2136(rplR)50S ribosomal protein L18  [1] (data from MRSA252)
    NWMN_1151(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_1572(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    NWMN_1549(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_2147(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    NWMN_2150(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    NWMN_2141(rplX)50S ribosomal protein L24  [1] (data from MRSA252)
    NWMN_0464(rplY)50S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    NWMN_1547(rpmA)50S ribosomal protein L27  [1] (data from MRSA252)
    NWMN_2144(rpmC)50S ribosomal protein L29  [1] (data from MRSA252)
    NWMN_2024(rpmE2)50S ribosomal protein L31 type B  [1] (data from MRSA252)
    NWMN_2126(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    NWMN_0505(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    NWMN_1385(rpsA)30S ribosomal protein S1  [1] (data from MRSA252)
    NWMN_1166(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_2146(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_1613(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_0357(rpsF)30S ribosomal protein S6  [1] (data from MRSA252)
    NWMN_0508(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    NWMN_2138(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    NWMN_2119(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    NWMN_2153(rpsJ)30S ribosomal protein S10  [1] (data from MRSA252)
    NWMN_2127(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_2128(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    NWMN_1182(rpsO)30S ribosomal protein S15  [1] (data from MRSA252)
    NWMN_1148(rpsP)30S ribosomal protein S16  [1] (data from MRSA252)
    NWMN_2143(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    NWMN_2148(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    NWMN_0055(spa)immunoglobulin G binding protein A precursor (protein A)  [1] (data from MRSA252)
    NWMN_1326(sucA)2-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    NWMN_1325(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    NWMN_1155(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    NWMN_1156(sucD)succinyl-CoA synthetase subunit alpha  [1] (data from MRSA252)
    NWMN_1569(tig)trigger factor  [1] (data from MRSA252)
    NWMN_1254(tkt)transketolase  [1] (data from MRSA252)
    NWMN_1057(trxA)thioredoxin  [1] (data from MRSA252)
    NWMN_1167(tsf)elongation factor Ts  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_2016(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    NWMN_0017(vicR)response regulator protein  [1] (data from MRSA252)
    NWMN_02495'-nucleotidase, lipoprotein e(P4) family protein  [1] (data from MRSA252)
    NWMN_0475cysteine synthase-like protein  [1] (data from MRSA252)
    NWMN_0481pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    NWMN_0533hypothetical protein  [1] (data from MRSA252)
    NWMN_0601hypothetical protein  [1] (data from MRSA252)
    NWMN_0641hypothetical protein  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_0839fumarylacetoacetate hydrolase family protein  [1] (data from MRSA252)
    NWMN_0881enoyl-(acyl carrier protein) reductase  [1] (data from MRSA252)
    NWMN_0956hypothetical protein  [1] (data from MRSA252)
    NWMN_1128ribosomal RNA large subunit methyltransferase N  [1] (data from MRSA252)
    NWMN_1184RNA-metabolising metallo-beta-lactamase  [1] (data from MRSA252)
    NWMN_1263aconitate hydratase  [1] (data from MRSA252)
    NWMN_1382DNA-binding protein HU  [1] (data from MRSA252)
    NWMN_1600universal stress protein family protein  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_1621hypothetical protein  [1] (data from MRSA252)
    NWMN_1644dipeptidase PepV  [1] (data from MRSA252)
    NWMN_1831ferritin  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)
    NWMN_24541-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)
    NWMN_2503fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)
    NWMN_2504malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 0.83
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.198
    • Ymax_pos: 27
    • Cmax: 0.127
    • Cmax_pos: 29
    • Smax: 0.464
    • Smax_pos: 17
    • Smean: 0.297
    • D: 0.237
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKIAIIGAGIGGLTAAALLQEQGHTIKVFEKNESVKEIGAGIGIGDNVLKKLGNHDLAKGIKNAGQILSTMTVLDDKDRLLTTVKLKSNTLNVTLPRQTLIDIIKSYVKDDAIFTNHEVTHIDNETDKVTIHFAEQESEAFDLCIGADGIHSKVRQSVNADSKVLYQGYTCFRGLIDDIDLKHPDCAKEYWGRKGRVGIVPLLNNQAYWFITINSKENNHKYSSFGKPHLQAYFNHYPNEVREILDKQSETGILLHNIYDLKPLKSFVYGRTILLGDAAHATTPNMGQGAGQAMEDAIVLVNCFNAYDFEKALQRYDKIRVKHTAKVIKRSRKIGKIAQYRSRLFVAVRNRIMKMMPNALAAGQTKFLYKSKEK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]