From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0956 [new locus tag: NWMN_RS05355 ]
  • pan locus tag?: SAUPAN003312000
  • symbol: NWMN_0956
  • pan gene symbol?: rnjA
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0956 [new locus tag: NWMN_RS05355 ]
  • symbol: NWMN_0956
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1061008..1062705
  • length: 1698
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    ATGAAACAATTACATCCAAATGAAGTAGGTGTATATGCACTTGGAGGTCTAGGTGAAATC
    GGTAAAAATACTTATGCAGTTGAGTATAAAGACGAAATTGTCATTATCGATGCAGGTATC
    AAATTCCCTGATGATAACTTATTAGGGATTGATTATGTTATACCTGACTACACATATCTA
    GTTCAAAACCAAGATAAAATTGTTGGCCTATTTATAACACATGGTCACGAAGACCATATA
    GGCGGTGTGCCCTTCCTATTAAAACAACTTAATATACCTATTTATGGTGGTCCTTTAGCA
    TTAGGTTTAATCCGTAATAAACTTGAAGAACATCATTTATTACGTACTGCTAAACTAAAT
    GAAATCAATGAGGACAGTGTGATTAAATCTAAGCACTTTACGATTTCTTTCTACTTAACT
    ACACATAGTATTCCTGAAACTTATGGCGTCATCGTAGATACACCTGAAGGAAAAGTAGTT
    CATACCGGTGACTTTAAATTTGATTTTACACCTGTAGGCAAACCAGCAAACATTGCTAAA
    ATGGCTCAATTAGGCGAAGAAGGCGTTCTATGTTTACTTTCAGACTCAACAAATTCACTT
    GTGCCTGATTTTACTTTAAGCGAACGTGAAGTTGGTCAAAACGTAGATAAGATCTTCCGT
    AATTGTAAAGGTCGTATTATATTTGCTACCTTCGCTTCTAATATTTACCGAGTTCAACAA
    GCAGTTGAAGCTGCTATCAAAAATAACCGTAAAATTGTTACGTTCGGTCGTTCGATGGAA
    AACAATATTAAAATAGGTATGGAACTTGGTTATATTAAAGCACCACCTGAAACATTTATT
    GAACCTAATAAAATTAATACCGTACCGAAGCATGAGTTATTGATACTATGTACTGGTTCA
    CAAGGTGAACCAATGGCAGCATTATCTAGAATTGCTAATGGTACTCATAAGCAAATTAAA
    ATTATACCTGAAGATACCGTTGTATTTAGTTCATCACCTATCCCAGGTAATACAAAAAGT
    ATTAACAGAACTATTAATTCCTTGTATAAAGCTGGTGCAGATGTTATCCATAGCAAGATT
    TCTAACATCCATACTTCAGGGCATGGTTCTCAAGGTGATCAACAATTAATGCTTCGATTA
    ATCAAGCCGAAATATTTCTTACCTATTCATGGTGAATACCGTATGTTAAAAGCACATGGT
    GAGACTGGTGTTGAATGCGGCGTTGAAGAAGATAATGTCTTCATCTTTGATATTGGAGAT
    GTCTTAGCTTTAACACACGATTCAGCACGTAAAGCTGGTCGCATTCCATCTGGTAATGTA
    CTTGTTGATGGTAGTGGTATCGGTGATATCGGTAATGTTGTAATAAGAGACCGTAAGCTA
    TTATCTGAAGAAGGTTTAGTTATCGTTGTTGTTAGTATTGATTTTAATACAAATAAATTA
    CTTTCTGGTCCAGACATTATTTCTCGAGGATTTGTATATATGAGGGAATCAGGTCAATTA
    ATTTATGATGCACAACGCAAAATCAAAACTGATGTTATTAGTAAGTTAAATCAAAATAAA
    GATATTCAATGGCATCAGATTAAATCTTCTATCATTGAAACATTACAACCTTATTTATTT
    GAAAAAACAGCTAGAAAACCAATGATTTTACCAGTCATTATGAAGGTAAACGAACAAAAA
    GAATCAAACAATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1698

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0956 [new locus tag: NWMN_RS05355 ]
  • symbol: NWMN_0956
  • description: hypothetical protein
  • length: 565
  • theoretical pI: 7.3306
  • theoretical MW: 62668.7
  • GRAVY: -0.169735

Function[edit source | edit]

  • reaction:
    EC 3.1.-.-?  ExPASy
  • TIGRFAM:
    Genetic information processingTranscriptionDegradation of RNAbeta-CASP ribonuclease, RNase J family (TIGR00649; EC 3.1.-.-; HMM-score: 688.9)
    arCOG00543 universal archaeal KH-domain/beta-lactamase-domain protein (TIGR03675; HMM-score: 33.3)
    Genetic information processingTranscriptionRNA processingribonuclease Z (TIGR02651; EC 3.1.26.11; HMM-score: 25.1)
    Cellular processesCellular processesDetoxificationhydroxyacylglutathione hydrolase (TIGR03413; EC 3.1.2.6; HMM-score: 24)
    Cellular processesCellular processesDNA transformationDNA internalization-related competence protein ComEC/Rec2 (TIGR00361; HMM-score: 12.4)
  • TheSEED:  
    Bacterial RNA-metabolizing Zn-dependent hydrolases Ribonuclease J1 (endonuclease and 5' exonuclease) 
  • PFAM:
    Metallo-HOrase (CL0381) Lactamase_B; Metallo-beta-lactamase superfamily (PF00753; HMM-score: 62.8)
    RMMBL_DRMBL (CL0398) RMMBL; Zn-dependent metallo-hydrolase RNA specificity domain (PF07521; HMM-score: 40.6)
    Metallo-HOrase (CL0381) Lactamase_B_2; Beta-lactamase superfamily domain (PF12706; HMM-score: 37.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Zn2+
  • effectors:
  • protein partners:
    NWMN_2534(arcA)arginine deiminase  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_1574(infC)translation initiation factor IF-3  [1] (data from MRSA252)
    NWMN_0962(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0500(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_2149(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    NWMN_2152(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    NWMN_2151(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    NWMN_2140(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    NWMN_2137(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_0502(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    NWMN_2133(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    NWMN_2145(rplP)50S ribosomal protein L16  [1] (data from MRSA252)
    NWMN_1151(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_1572(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    NWMN_1549(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_2147(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    NWMN_2150(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    NWMN_1166(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_2146(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_1613(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_0508(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    NWMN_2119(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    NWMN_2127(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_1182(rpsO)30S ribosomal protein S15  [1] (data from MRSA252)
    NWMN_2143(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    NWMN_2148(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    NWMN_1325(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    NWMN_0785(sufC)FeS assembly ATPase SufC  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_02495'-nucleotidase, lipoprotein e(P4) family protein  [1] (data from MRSA252)
    NWMN_0641hypothetical protein  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_1382DNA-binding protein HU  [1] (data from MRSA252)
    NWMN_1600universal stress protein family protein  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_1985ATP-dependent RNA helicase DEAD box family protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.118
    • Ymax_pos: 27
    • Cmax: 0.155
    • Cmax_pos: 27
    • Smax: 0.131
    • Smax_pos: 1
    • Smean: 0.092
    • D: 0.108
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKQLHPNEVGVYALGGLGEIGKNTYAVEYKDEIVIIDAGIKFPDDNLLGIDYVIPDYTYLVQNQDKIVGLFITHGHEDHIGGVPFLLKQLNIPIYGGPLALGLIRNKLEEHHLLRTAKLNEINEDSVIKSKHFTISFYLTTHSIPETYGVIVDTPEGKVVHTGDFKFDFTPVGKPANIAKMAQLGEEGVLCLLSDSTNSLVPDFTLSEREVGQNVDKIFRNCKGRIIFATFASNIYRVQQAVEAAIKNNRKIVTFGRSMENNIKIGMELGYIKAPPETFIEPNKINTVPKHELLILCTGSQGEPMAALSRIANGTHKQIKIIPEDTVVFSSSPIPGNTKSINRTINSLYKAGADVIHSKISNIHTSGHGSQGDQQLMLRLIKPKYFLPIHGEYRMLKAHGETGVECGVEEDNVFIFDIGDVLALTHDSARKAGRIPSGNVLVDGSGIGDIGNVVIRDRKLLSEEGLVIVVVSIDFNTNKLLSGPDIISRGFVYMRESGQLIYDAQRKIKTDVISKLNQNKDIQWHQIKSSIIETLQPYLFEKTARKPMILPVIMKVNEQKESNNK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]