From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0481 [new locus tag: NWMN_RS02815 ]
  • pan locus tag?: SAUPAN002283000
  • symbol: NWMN_0481
  • pan gene symbol?: pdxS
  • synonym:
  • product: pyridoxal biosynthesis lyase PdxS

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0481 [new locus tag: NWMN_RS02815 ]
  • symbol: NWMN_0481
  • product: pyridoxal biosynthesis lyase PdxS
  • replicon: chromosome
  • strand: +
  • coordinates: 554055..554942
  • length: 888
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGAGTAAAATTATTGGATCAGACAGAGTCAAAAGAGGTATGGCTGAAATGCAAAAAGGC
    GGCGTTATTATGGATGTCGTTAATGCTGAGCAAGCAAGAATTGCAGAAGAAGCTGGCGCG
    GTAGCAGTTATGGCATTAGAACGAGTACCTTCTGATATTAGAGCTGCTGGTGGTGTTGCA
    CGTATGGCAAACCCTAAAATTGTAGAAGAAGTAATGAATGCTGTTTCTATTCCAGTCATG
    GCTAAAGCACGTATTGGTCATATCACTGAAGCAAGAGTATTAGAGGCGATGGGTGTTGAC
    TATATTGATGAATCAGAAGTGTTAACACCAGCAGATGAGGAATATCACTTAAGAAAAGAT
    CAATTTACAGTACCATTTGTATGTGGATGTCGTAATTTAGGTGAAGCTGCGCGTAGAATT
    GGTGAAGGTGCTGCTATGTTACGTACTAAAGGTGAACCAGGTACAGGTAATATTGTTGAA
    GCTGTAAGACATATGAGACAAGTTAATTCAGAAGTTAGTCGATTGACTGTAATGAATGAT
    GATGAGATTATGACTTTTGCGAAAGATATCGGTGCGCCTTATGAAATTTTAAAACAAATT
    AAAGACAATGGTCGTTTACCGGTAGTTAACTTTGCAGCTGGTGGCGTTGCGACTCCTCAA
    GATGCTGCTTTAATGATGGAATTAGGTGCTGACGGTGTATTCGTTGGATCAGGTATTTTT
    AAATCAGAAGATCCAGAAAAATTTGCTAAAGCAATTGTTCAAGCAACAACACATTACCAA
    GACTATGAACTAATTGGAAGATTAGCAAGTGAACTTGGCACTGCTATGAAAGGTTTAGAT
    ATCAATCAATTATCATTAGAAGAACGTATGCAAGAGCGTGGTTGGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    888

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0481 [new locus tag: NWMN_RS02815 ]
  • symbol: NWMN_0481
  • description: pyridoxal biosynthesis lyase PdxS
  • length: 295
  • theoretical pI: 4.83393
  • theoretical MW: 31992.6
  • GRAVY: -0.130847

Function[edit source | edit]

  • reaction:
    EC 4.3.3.6?  ExPASy
    Pyridoxal 5'-phosphate synthase (glutamine hydrolyzing)D-ribose 5-phosphate + D-glyceraldehyde 3-phosphate + L-glutamine = pyridoxal 5'-phosphate + L-glutamate + 3 H2O + phosphate
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridoxinepyridoxal 5'-phosphate synthase, synthase subunit Pdx1 (TIGR00343; HMM-score: 505.6)
    Unknown functionGeneralputative TIM-barrel protein, nifR3 family (TIGR00737; HMM-score: 32.5)
    putative enoyl-[acyl-carrier-protein] reductase II (TIGR03151; EC 1.3.1.-; HMM-score: 23.2)
    glycosyl amidation-associated protein WbuZ (TIGR03572; HMM-score: 20.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiamine-phosphate diphosphorylase (TIGR00693; EC 2.5.1.3; HMM-score: 19.7)
    MetabolismEnergy metabolismGlycolysis/gluconeogenesistriose-phosphate isomerase (TIGR00419; EC 5.3.1.1; HMM-score: 18.2)
    3-hexulose-6-phosphate synthase (TIGR03128; EC 4.1.2.43; HMM-score: 18)
    MetabolismAmino acid biosynthesisHistidine family1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase (TIGR00007; EC 5.3.1.16; HMM-score: 17.1)
    MetabolismAmino acid biosynthesisAromatic amino acid familytryptophan synthase, alpha subunit (TIGR00262; EC 4.2.1.20; HMM-score: 16.7)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPyrimidine ribonucleotide biosynthesisorotidine 5'-phosphate decarboxylase (TIGR01740; EC 4.1.1.23; HMM-score: 16.4)
    dihydroorotate dehydrogenase family protein (TIGR01037; EC 1.3.-.-; HMM-score: 15.8)
    Unknown functionGeneralhisA/hisF family protein (TIGR00734; HMM-score: 15.6)
    methylmalonyl-CoA mutase C-terminal domain (TIGR00640; HMM-score: 15.1)
    MetabolismAmino acid biosynthesisHistidine familyimidazoleglycerol phosphate synthase, cyclase subunit (TIGR00735; HMM-score: 15.1)
    geranylgeranylglyceryl phosphate synthase family protein (TIGR01768; EC 2.5.1.-; HMM-score: 13.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherisopentenyl-diphosphate delta-isomerase, type 2 (TIGR02151; EC 5.3.3.2; HMM-score: 12.7)
  • TheSEED:  
    Pyridoxin (Vitamin B6) Biosynthesis Pyridoxal 5'-phosphate synthase (glutamine hydrolyzing), synthase subunit (EC 4.3.3.6) 
  • PFAM:
    TIM_barrel (CL0036) SOR_SNZ; SOR/SNZ family (PF01680; HMM-score: 356.8)
    ThiG; Thiazole biosynthesis protein ThiG (PF05690; HMM-score: 46.9)
    Dus; Dihydrouridine synthase (Dus) (PF01207; HMM-score: 28.8)
    IGPS; Indole-3-glycerol phosphate synthase (PF00218; HMM-score: 24.4)
    His_biosynth; Histidine biosynthesis protein (PF00977; HMM-score: 22.8)
    NMO; Nitronate monooxygenase (PF03060; HMM-score: 22.3)
    NanE; Putative N-acetylmannosamine-6-phosphate epimerase (PF04131; HMM-score: 21.1)
    OMPdecase; Orotidine 5'-phosphate decarboxylase / HUMPS family (PF00215; HMM-score: 20.4)
    DUF561; Protein of unknown function (DUF561) (PF04481; HMM-score: 17.3)
    FMN_dh; FMN-dependent dehydrogenase (PF01070; HMM-score: 15.5)
    IMPDH; IMP dehydrogenase / GMP reductase domain (PF00478; HMM-score: 15.5)
    TMP-TENI; Thiamine monophosphate synthase (PF02581; HMM-score: 15)
    no clan definedPhage_Cox; Regulatory phage protein cox (PF10743; HMM-score: 13.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_1587(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    NWMN_1483(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_0745(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_0961(pdhC)branched-chain alpha-keto acid dehydrogenase subunit E2  [1] (data from MRSA252)
    NWMN_0962(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_0960(phdB)pyruvate dehydrogenase E1 component, beta subunit  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_0500(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_2149(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    NWMN_2140(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_0502(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    NWMN_2133(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    NWMN_1151(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_1572(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    NWMN_1549(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_2147(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    NWMN_2150(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    NWMN_2024(rpmE2)50S ribosomal protein L31 type B  [1] (data from MRSA252)
    NWMN_2126(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    NWMN_2146(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_2127(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_1326(sucA)2-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    NWMN_1325(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_0839fumarylacetoacetate hydrolase family protein  [1] (data from MRSA252)
    NWMN_1382DNA-binding protein HU  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)
    NWMN_2504malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.125
    • Ymax_pos: 11
    • Cmax: 0.212
    • Cmax_pos: 56
    • Smax: 0.215
    • Smax_pos: 1
    • Smean: 0.141
    • D: 0.131
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSKIIGSDRVKRGMAEMQKGGVIMDVVNAEQARIAEEAGAVAVMALERVPSDIRAAGGVARMANPKIVEEVMNAVSIPVMAKARIGHITEARVLEAMGVDYIDESEVLTPADEEYHLRKDQFTVPFVCGCRNLGEAARRIGEGAAMLRTKGEPGTGNIVEAVRHMRQVNSEVSRLTVMNDDEIMTFAKDIGAPYEILKQIKDNGRLPVVNFAAGGVATPQDAALMMELGADGVFVGSGIFKSEDPEKFAKAIVQATTHYQDYELIGRLASELGTAMKGLDINQLSLEERMQERGW

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]