From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1831 [new locus tag: NWMN_RS10520 ]
  • pan locus tag?: SAUPAN004915000
  • symbol: NWMN_1831
  • pan gene symbol?: ftnA
  • synonym:
  • product: ferritin

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1831 [new locus tag: NWMN_RS10520 ]
  • symbol: NWMN_1831
  • product: ferritin
  • replicon: chromosome
  • strand: +
  • coordinates: 2037923..2038423
  • length: 501
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    ATGTTAAGTAAAAATTTATTAGAAGCATTAAATGATCAAATGAACCATGAGTACTTTGCA
    GCACACGCATATATGGCAATGGCAGCATACTGTGATAAAGAATCGTACGAAGGATTTGCA
    AACTTCTTCATTCAACAAGCTAAAGAAGAACGTTTCCATGGACAAAAGATTTATAACTAT
    ATTAACGACAGAGGTGCACATGCAGAATTCAGAGCAGTTTCAGCACCAAAAATTGACTTT
    TCAAGCATACTAGAAACTTTCAAAGACAGCTTATCTCAAGAACAAGAAGTAACAAGACGT
    TTCTATAACTTATCTGAAATCGCTCGTCAAGATAAAGATTATGCAACTATCTCATTCTTA
    AACTGGTTCTTAGATGAACAAGTCGAAGAAGAATCAATGTTTGAAACTCACATCAATTAT
    TTAACTCGTATCGGCGATGACAGCAATGCATTATATCTTTACGAAAAAGAACTTGGCGCT
    CGTACATTCGACGAAGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    501

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_1831 [new locus tag: NWMN_RS10520 ]
  • symbol: NWMN_1831
  • description: ferritin
  • length: 166
  • theoretical pI: 4.36232
  • theoretical MW: 19588.5
  • GRAVY: -0.63253

Function[edit source | edit]

  • reaction:
    EC 1.16.3.2?  ExPASy
    Bacterial non-heme ferritin4 Fe2+ + O2 + 6 H2O = 4 (FeO(OH)) + 8 H+
  • TIGRFAM:
    MetabolismTransport and binding proteinsCations and iron carrying compoundsbacterioferritin (TIGR00754; HMM-score: 13.9)
  • TheSEED:  
    Ferritin-like protein 2 
  • PFAM:
    Ferritin (CL0044) Ferritin; Ferritin-like domain (PF00210; HMM-score: 144.2)
    Rubrerythrin; Rubrerythrin (PF02915; HMM-score: 20.6)
    P-loop_NTPase (CL0023) DUF2075; Uncharacterized conserved protein (DUF2075) (PF09848; HMM-score: 14.7)
    AB_hydrolase (CL0028) PAE; Pectinacetylesterase (PF03283; HMM-score: 13.9)
    Ferritin (CL0044) Ferritin_2; Ferritin-like domain (PF13668; HMM-score: 13.2)
    Coat_F; Coat F domain (PF07875; HMM-score: 12.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_1433(efp)elongation factor P  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_1217(glnA)glutamine synthetase  [1] (data from MRSA252)
    NWMN_2446(mvaS)3-hydroxy-3-methylglutaryl coenzyme A synthase  [1] (data from MRSA252)
    NWMN_2040(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_0877(ppnK)inorganic polyphosphate/ATP-NAD kinase  [1] (data from MRSA252)
    NWMN_2149(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    NWMN_2145(rplP)50S ribosomal protein L16  [1] (data from MRSA252)
    NWMN_2147(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    NWMN_1573(rpmI)50S ribosomal protein L35  [1] (data from MRSA252)
    NWMN_0507(rpsL)30S ribosomal protein S12  [1] (data from MRSA252)
    NWMN_1148(rpsP)30S ribosomal protein S16  [1] (data from MRSA252)
    NWMN_1155(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.136
    • Ymax_pos: 21
    • Cmax: 0.142
    • Cmax_pos: 69
    • Smax: 0.204
    • Smax_pos: 19
    • Smean: 0.125
    • D: 0.132
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MLSKNLLEALNDQMNHEYFAAHAYMAMAAYCDKESYEGFANFFIQQAKEERFHGQKIYNYINDRGAHAEFRAVSAPKIDFSSILETFKDSLSQEQEVTRRFYNLSEIARQDKDYATISFLNWFLDEQVEEESMFETHINYLTRIGDDSNALYLYEKELGARTFDEE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]