Due to technical reasons this service will not be available for 7 days from 27 Nov to 04 Dec 2017
From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS00860 [old locus tag: SA0138 ]
  • pan locus tag?: SAUPAN000957000
  • symbol: SA_RS00860
  • pan gene symbol?: phnD
  • synonym:
  • product: phosphonate ABC transporter substrate-binding protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS00860 [old locus tag: SA0138 ]
  • symbol: SA_RS00860
  • product: phosphonate ABC transporter substrate-binding protein
  • replicon: chromosome
  • strand: -
  • coordinates: 157652..158608
  • length: 957
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (157652..158608) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGAAAAATTTTAAGTATTTATTTGTATTAATGTTAGCAGTCATTGTTTTTGCAGCAGCA
    TGTGGAAACTCAAGTTCTTTAGATAATCAAAAGAACGCTAGTAATGATTCGGATTCTAAA
    TCAGGAGGATACAAACCTAAAGAATTAACAGTACAATTTGTACCTTCGCAAAATGCTGGA
    ACATTAGAGGCTAAAGCAAAACCATTAGAAAAATTACTATCTAAAGAATTAGGAATTCCA
    GTTAAAGTGTCTGTATCAACTAACTACAATACAATTGTTGAAGCTATGAAGTCTAAAAAA
    GTTGATGTTGGTTTCTTACCACCAACGGCATACACATTAGCACATGATCAAAAAGCAGCT
    GATTTATTATTACAAGCACAACGTTTTGGTGTAAAAGAAGATGGTTCAGCAAGTAAAGAA
    CTTGTAGATAGTTATAAATCAGAAATTCTTGTTAAAAAAGACTCAAAAATTAAAAGCTTG
    AAAGATTTAAAAGGTAAGAAAATTGCCTTACAAGATGTAACATCAACTGCTGGATATACA
    TTCCCACTTGCGATGTTAAAAAACGAAGCAGGTATTAATGCAACTAAAGATATGAAAATT
    GTGAATGTTAAAGGTCATGACCAAGCAGTTATCTCATTATTAAATGGAGATGTAGATGCT
    GCGGCTGTATTTAACGATGCACGTAATACTGTGAAAAAAGACCAACCAAATGTATTTAAA
    GACACACGAATTTTAAAATTAACACAAGCTATTCCGAATGACACAATTTCTGTAAGACCA
    GATATGGATAAAGATTTCCAAGAAAAATTGAAAAAAGCTTTTATAGACATTGCTAAATCA
    AAAGAAGGTCACAAAATTATTAGCGAAGTTTATTCACATGAAGGATACACAGAAACGAAA
    GATTCAAATTTCGACATTGTAAGAGAGTACGAAAAATTAGTTAAAGATATGAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    957

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS00860 [old locus tag: SA0138 ]
  • symbol: SA_RS00860
  • description: phosphonate ABC transporter substrate-binding protein
  • length: 318
  • theoretical pI: 9.72148
  • theoretical MW: 35060.1
  • GRAVY: -0.405031

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsAnionsphosphate/phosphite/phosphonate ABC transporter, periplasmic binding protein (TIGR01098; HMM-score: 256.4)
    phosphonate ABC transporter, periplasmic phosphonate binding protein (TIGR03431; HMM-score: 173.2)
    putative selenate ABC transporter periplasmic binding protein (TIGR04553; HMM-score: 76.2)
    MetabolismTransport and binding proteinsOtherABC transporter, substrate-binding protein, aliphatic sulfonates family (TIGR01728; HMM-score: 54.3)
    taurine ABC transporter, periplasmic binding protein (TIGR01729; HMM-score: 46.2)
    MetabolismTransport and binding proteinsUnknown substrateTRAP transporter solute receptor, TAXI family (TIGR02122; HMM-score: 37.4)
    MetabolismTransport and binding proteinsAmino acids, peptides and amineslysine-arginine-ornithine-binding periplasmic protein (TIGR01096; HMM-score: 22.2)
  • TheSEED:
  • PFAM:
    PBP (CL0177) Phosphonate-bd; ABC transporter, phosphonate, periplasmic substrate-binding protein (PF12974; HMM-score: 241.7)
    NMT1; NMT1/THI5 like (PF09084; HMM-score: 48.4)
    SBP_bac_3; Bacterial extracellular solute-binding proteins, family 3 (PF00497; HMM-score: 44.1)
    NMT1_2; NMT1-like family (PF13379; HMM-score: 24.1)
    Mycoplasma_p37; High affinity transport system protein p37 (PF06646; HMM-score: 23.8)
    NMT1_3; NMT1-like family (PF16868; HMM-score: 21.3)
    Hexosaminidase (CL0546) Glyco_hydro_20b; Glycosyl hydrolase family 20, domain 2 (PF02838; HMM-score: 13.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 3.33
    • Cellwall Score: 3.33
    • Extracellular Score: 3.33
    • Internal Helix: 1
  • LocateP:
  • SignalP: Signal peptide length 34 aa
    • Ymax: 0.397
    • Ymax_pos: 34
    • Cmax: 0.227
    • Cmax_pos: 34
    • Smax: 0.973
    • Smax_pos: 17
    • Smean: 0.833
    • D: 0.567
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

  • GI: 446710431 NCBI
  • RefSeq: WP_000787777 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKNFKYLFVLMLAVIVFAAACGNSSSLDNQKNASNDSDSKSGGYKPKELTVQFVPSQNAGTLEAKAKPLEKLLSKELGIPVKVSVSTNYNTIVEAMKSKKVDVGFLPPTAYTLAHDQKAADLLLQAQRFGVKEDGSASKELVDSYKSEILVKKDSKIKSLKDLKGKKIALQDVTSTAGYTFPLAMLKNEAGINATKDMKIVNVKGHDQAVISLLNGDVDAAAVFNDARNTVKKDQPNVFKDTRILKLTQAIPNDTISVRPDMDKDFQEKLKKAFIDIAKSKEGHKIISEVYSHEGYTETKDSNFDIVREYEKLVKDMK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS00860 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]